Thursday, September 17, 2026
No menu items!
HomeNatureSynthetic GPCRs for programmable sensing and control of cell behaviour

Synthetic GPCRs for programmable sensing and control of cell behaviour

Plasmid constructs and cloning

Constructs used for transient expression in HEK293T cells were cloned into the pAAV viral vector. For stable expression, the constructs were cloned into the pCDH viral vector. For all constructs, standard cloning procedures were used. PCR fragments were amplified using Q5 polymerase (NEB). Vectors were digested with NEB restriction enzymes and ligated to gel-purified PCR products using T4 ligation, Gibson, NEB HiFi, or Golden Gate assembly. Ligated plasmids were introduced into competent XL1-Blue, NEB5-alpha, or NEB Stable bacteria via heat shock transformation.

Cell lines

HEK293T and RAW 264.7 cells were obtained from ATCC (tested negative for mycoplasma) and cultured as monolayers in complete growth medium: Dulbecco’s Modified Eagle Medium (DMEM, Corning) containing 4.5 g l−1 glucose and supplemented with 10% Fetal Bovine Serum (FBS, VWR), 1% (v/v) GlutaMAX (Gibco), and 1% (v/v) Penicillin-Streptomycin (Corning, 5,000 units ml−1 of penicillin and 5,000 μg ml−1 streptomycin). Nalm6 B-ALL cells stably expressing GFP and firefly luciferase (Nalm6-GL) cells were provided by Crystal Mackall and cultured between 0.25–1.5 × 106 cells  per ml in complete growth medium: RPMI-1640 Medium (Corning) supplemented with 10% Fetal Bovine Serum (FBS, VWR), 1% (v/v) GlutaMAX (Gibco), and 1% (v/v) Penicillin-Streptomycin (Corning, 5,000 units ml−1 of penicillin and 5,000 μg ml−1 streptomycin). All cell lines were cultured at 37 °C under 5% CO2. For experimental assays, HEK293T cells were grown in 6-well, 12-well, 24-well, or 96-well plates pretreated with 20 µg ml−1 human fibronectin (Millipore) for at least 10 min at 37 °C.

Source of primary human T cells

Buffy coats from healthy donors were purchased from the Stanford Blood Center under an IRB-exempt-protocol. Primary human T cells were purified by negative selection using the RosetteSep Human T cell Enrichment kit (StemCell Technologies) and SepMate-50 tubes. T cells were cryopreserved at 4 × 106 cells per ml in CryoStor CS10 cryopreservation medium (StemCell Technologies) until use. T cells were cultured in complete growth medium: RPMI-1640 Medium (Corning) supplemented with 10% Fetal Bovine Serum (FBS, VWR), 1% (v/v) GlutaMAX (Gibco), 40 units ml−1 rhIL-2 (PeptoTech), and 1% (v/v) Penicillin-Streptomycin (Corning, 5,000 units ml−1 of penicillin and 5,000 μg ml−1 streptomycin).

Expression and purification of recombinant GFP and mCherry

Recombinant His-tagged GFP and mCherry were expressed in E. col BL21(DE3). In brief, a 5 ml starter culture in 2× YT supplemented with antibiotic was grown overnight at 37 °C. The starter culture was diluted into 1 l of the same medium and grown at 37 °C to an OD600 of ~0.8. and induced with 1 mM IPTG at 22 °C for 18 h. Cells were collected by centrifugation and lysed with Bacterial Protein Extraction Reagent (BPER, Thermo Scientific) supplemented with protease inhibitor cocktail per the manufacturer’s instructions. Lysate was filtered using a 5-μm syringe filter and purified by FPLC on a Ni-NTA column. Eluted protein was dialysed overnight at 4 °C into 20 mM Tris pH 7.5, 150 mM NaCl. GFP storage buffer included 1 mM TCEP. Protein concentration was determined with spectrophotometry and diluted to 500 μM. Protein was aliquoted and frozen at −80 °C for long term storage.

HEK293T cell transient transfection

A 1 mg ml−1 solution of PEI Max (Polysciences, 24765) was prepared for transient transfection as follows. Polyethylenimine (PEI, 500 mg) was added to 450 ml of Milli-Q H20 in a 500 ml glass beaker while stirring with a stir bar. Concentrated HCL was added dropwise to the solution until the pH was less than 2.0. The PEI solution was stirred until PEI was dissolved (~2–3 h). Concentrated NaOH was then added dropwise to the solution until the pH was 7.0. The volume of the solution was then adjusted to 500 ml, filter-sterilized through a 0.22-μm membrane, and frozen in aliquots at −20 °C. Working stocks were kept at 4 °C for no more than 1 month.

For transient transfection, HEK293T cells were grown in 6-well, 12-well, or 24-well plates pretreated with 20 µg ml−1 human fibronectin (Millipore) for at least 10 min at 37 °C. Cells were grown to a confluency of ~70–90% prior to transfection. DNA transfection complexes were made by mixing DNA and 1 mg ml−1 PEI solution in serum-free DMEM at a 1 μg DNA: 5 μl PEI (1 mg ml−1): 100 μl serum-free DMEM. Complexes were allowed to form for 20 min at room temperature. After 20 min, complexes were diluted in complete DMEM up to the growth volume per well size (2.5 ml for 6-well, 1 ml for 12-well, and 500 μl for 24-well). The entire well volume of the HEK293T cells was replaced with the diluted complexes and allowed to transfect cells at 37 °C for 5–24 h. Complete transfection protocols including amounts of DNA and length of transfection are described for each experiment below.

Firefly luciferase reporter PAGERTF experiments

HEK293T cells were plated in human fibronectin-coated 6-well dishes at a density of 750,000 cells per well and allowed to grow overnight (~18 h) at 37 °C until they reached ~70–90% confluency. After ~18 h, the cells were transfected with 350 ng of the indicated Antagonist-Nanobody-GPCR-eLOV-TEVcs-Gal4 (PAGERTF) receptor plasmid, 100 ng of NanoLuc-β-arrestin2-TEVp plasmid, and 150 ng of UAS-Firefly Luciferase (FLuc) plasmid. Cells were transfected for 5 h at 37 °C. After 5 h of transfection, cells from each well were lifted and resuspended in 6 ml of complete DMEM to make an ~400,000 cells per ml single cell suspension, and 100 μl of cell suspension (~40,000 cells) was plated per well in a human fibronectin-coated white, clear bottom 96-well plate in triplicate. Plates were wrapped in aluminum foil to protect them from light and incubated at 37 °C overnight (~18 h). After ~18 h, cells should be stimulated.

Stimulation was performed in a dark room with a red light source (red light does not open the LOV domain). Stimulation solutions were optimized for each given antigen and PAGER receptor. Unless otherwise indicated, PAGERs were stimulated as follows: GFP (LaG17/LaG2/LaG16)-PAGERs were stimulated with 1 μM GFP, 1 μM SalB, and 1× furimazine; mCherry (LaM6)-PAGERs were stimulated with 1 μM mCherry, 1 μM SalB, and 1× furimazine; VEGF (Nb35)-PAGERs were stimulated with 500 nM VEGF, 500 nM SalB, and 1× furimazine; HGF (Nb1E2)-PAGERs were stimulated with 250 nM HGF, 250 nM SalB, and 1× furimazine; TNF (ozoralizumab)-PAGERs were stimulated with 500 nM TNF, 250 nM or 500 nM SalB, and 1× furimazine; IL-17 (Sonelokimab)-PAGER was stimulated with 500 nM IL-17, 100 nM SalB, and 1× furimazine, IL-23 (Nb22E11)-PAGER was stimulated with 250 nM IL-23, 500 nM SalB, and 1× furimazine; sL6R (Voberilizumab)-PAGER was stimulated with 500 nM sIL-6R, 500 nM SalB, and 1× furimazine; CCL2 (Nb8E10)-PAGER was stimulated with 1 μM CCL2, 500 nM SalB, and 1× furimazine; EGFR (NbEgB4)-PAGERs were stimulated with 500 nM EGFR ECD, 100 nM or 250 nM or 500 nM SalB, and 1× furimazine; HER2 (Nb2Rs15d)-PAGERs were stimulated with 500 nM HER2 ECD, 500 nM or 1 μM SalB, and 1× furimazine; CD38 (NbMU375)-PAGER was stimulated with 1 μM CD38 ECD, 500 nM SalB, and 1× furimazine; PD-L1 (KN035)-PAGER was stimulated with 1 SalBPD-L1 ECD, 500 nM SalB, and 1× furimazine; SARS-CoV-2 RBD (NbF2)-PAGER was stimulated with 200 nM SARS-CoV-2 spike protein, 500 nM or 1 μM SalB, and 1× furimazine; uPA (Nb4)-PAGER was stimulated with 500 nM uPA, 250 nM or 500 nM SalB, and 1× furimazine.

For stimulations, growth medium was removed from the 96-well plate by flicking off and dabbing excess on a paper towel. To initiate stimulation, 100 μl stimulation solution was added to each well for a total of 15 min. After 15 min, stimulation solution was removed by flicking off and dabbing excess on a paper towel, and 100 μl of complete DMEM was added back to each well. Plates were again wrapped in aluminum foil and placed in 37 °C incubator for 8 h. After 8 h post-stimulation, medium was removed from 96-well plate by flicking off and dabbing excess on paper towel. Wells were washed once with 125 μl DPBS, and then 50 μl of 1× Bright-Glo (2× diluted 1:1 in DPBS; Promega) was added to each well and incubated for 1 min. After 1 min, firefly luciferase luminescence was measured using a Tecan Infinite M1000 Pro plate reader using the following parameters: 1,000 ms acquisition time, green-1 filter (520–570 nm), 25 °C linear shaking for 10 s.

In experiments where TEVp was used to activate PAGER, 1 μM recombinant TEVp was added to PAGER-expressing cells for 90 min prior to stimulation. In some experiments where indicated, exogenous ambient room white light was used to uncage the LOV domain instead of furimazine-dependent NanoLuc BRET. In these experiments, furimazine was not included in the stimulation solutions; all else remained the same. In some experiments where indicated, SalB or antigeSalB n dose–response curves were analysed. In these experiments, the concentrations of SalB or antigen were included in the stimulation solutions at different concentrations as indicated; all else remained the same.

HEK293T co-culture for trans assays

For trans assays using co-plated HEK293T cells, cells were cultured in 6-well and 12-well plates as described above. Receiver cells in 12-well plates were transfected with 140 ng of the indicated pAAV-Antagonist-Nanobody-PAGER-eLOV-TEVcs-Gal4 receptor plasmid, 40 ng of pAAV-NanoLuc-βarrestin2-TEVp plasmid, and 60 ng of pAAV-UAS-Firefly Luciferase (FLuc) plasmid. Sender cells in 6-well plates were transfected with 2 μg of pAAV-GFP-PDGFR transmembrane domain (surface-expressed GFP). Cells were transfected for 5 h in a 37 °C incubator. After 5 h, cells were lifted with trypsin, washed with DPBS, and resuspended in 6.25 ml or 2.5 ml of complete DMEM per well for 6-well and 12-well plates, respectively. Sender and receiver cells were mixed at a 4:1 sender:receiver ratio and then 100 μl of cell mixtures were plated into 96-well white, clear-bottom microplates at a density of 40,000 cells per well. Plates were wrapped in aluminum foil and incubated for ~18 h in a 37 °C incubator, then the stimulations and luciferase reporter assay were performed as described above.

HEK293T and macrophage differentiation co-culture assay

HEK293T cells were plated in human fibronectin-coated 6-well dishes at a density of 750,000 cells per well and allowed to grow overnight (~18 h) at 37 °C until they reached ~70–90% confluency. After ~18 h, the cells were transfected with 350 ng of the indicated PAGERTF receptor plasmid, 100 ng of NanoLuc-βarrestin2-TEVp plasmid, and 75 ng of UAS-mouse IFNγ plasmid. Cells were transfected for 5 h at 37 °C. After 5 h of transfection, cells from each well were lifted and resuspended to 1 × 106 cells per ml in complete DMEM. 250 μl of cell suspension (~250,000 cells) were plated in the top chamber of fibronectin-coated 24-well Transwells (8-μm pore size). Plates were wrapped in aluminum foil to protect them from light and incubated at 37 °C overnight (~18 h). After ~18 h, cells were stimulated in a dark room under red light with 100 μl of 500 nM Sal B, 1× furimazine, and antigen (2 μM mCherry, 500 nM VEGF, 500 nM CCL2, or 1 μM PD-L1) for 15 min. After 15 min, stimulations were removed and replaced with 200 μl complete DMEM. Immediately following stimulation, 400 μl of 2.5 × 105 RAW 264.7 macropahge cells (~100,000 cells) were placed in the bottom chamber of the Transwell. A final concentration of 10 ng ml−1 mouse IFNγ was added to the bottom chamber of the positive control well. Plates were then wrapped in aluminum foil to protect them from light and incubated at 37 °C for 48 h before being readout by imaging to assess morphological changes and qPCR with reverse transcription (RT–qPCR) to measure induction of the M1 macrophage markers CD86 and NOS2. Images of macrophages (at 20×) were taken using an Echo Rebel inverted microscope. Schematic summary of HEK293T and macrophage differentiation co-culture assay was created, in part, using BioRender.

RT–qPCR for macrophage markers

At time of collection, the medium from each samples was aspirated, and cold D-PBS was immediately added to each well. The cells were then pelleted, and RNA was extracted using the RNeasy Mini Kit (Qiagen, 74104). To synthesize cDNA, 1 µg of total RNA (8 µl) from each group was combined with 2 µl of Superscript IV VILO Master Mix (Thermo Scientific, 11756050) and subjected to the following thermocycling protocol: 25 °C for 10 min, 50 °C for 10 min, and 85 °C for 5 min. After reverse transcription, the cDNA was diluted tenfold in nuclease-free water. qPCR was conducted in 384-well plates using the CFX Connect Real-Time System (Bio-Rad), with a total reaction volume of 10 µl per well. Each reaction consisted of 2.5 µl of diluted cDNA template, 2.5 µl of 1 µM forward and reverse primers, and 5 µl of 2× Maxima SYBR Green/ROX qPCR Master Mix (Thermo Scientific, K0221). The following primer sequences were used: UBC-FWD: GACCCTGACAGGCAAGACCATC; UBC-REV: CTGTGGTGAGGAAGGTACGTCTG; CD86-FWD: CTGTCAGTGATCGCCAACTTCAGTG; CD86-REV: CCTTGCTTAGACGTGCAGGTC; NOS2-FWD: CCTTGTGCTGTTCTCAGCCCAAC; NOS2-REV: CAGGGATTCTGGAACATTCTGTGC.

The thermal cycling protocol included an initial denaturation step at 95 °C for 3 min, followed by 40 cycles of 95 °C for 10 s and 60 °C for 30 s. A melt-curve analysis was performed from 65 °C to 95 °C, with 0.5 °C increments. Housekeeping gene Ubc was used as the reference gene for normalization. Data were analysed as follows: first, ΔCT was calculated as target CT – Ubc (housekeeping control) CT; second, ΔΔCT was calculated as target ΔCT – untreated (negative control) ΔCT; and finally, relative gene expression was calculated as 2ΔΔCT for each sample.

HEK293T, T cell and tumour killing co-culture assay

HEK293T cells were plated in human fibronectin-coated 6-well dishes at a density of 750,000 cells per well and allowed to grow overnight (~18 h) at 37 °C until they reached ~70–90% confluency. After ~18 h, the cells were transfected with 350 ng of the indicated PAGERTF receptor plasmid, 100 ng of NanoLuc-βarrestin2-TEVp plasmid, and 25 ng of UAS-CD3-CD19 BiTE plasmid. Cells were transfected for 5 h at 37 °C. After 5 h of transfection, cells from each well were lifted and resuspended in 6 ml of complete DMEM to make an ~400,000 cells per ml single cell suspension, and 100 μl of cell suspension (~40,000 cells) was plated per well in a human fibronectin-coated clear 96-well plate in triplicate. Plates were wrapped in aluminum foil to protect them from light and incubated at 37 °C overnight (~18 h). After ~18 h, cells were stimulated in a dark room under red light with 50 μl of 250 nM Sal B, 1× furimazine, and antigen (2 μM GFP, 500 nM CCL2, or 1 μM PD-L1) for 15 min. After 15 min, stimulations were removed and replaced with 200 μl complete RPMI + 40 units ml−1 human IL-2 containing 100,000 primary human T cells and 100,000 Nalm6-GL cells (1:1 effector:target). Plates were then wrapped in aluminum foil to protect them from light and incubated at 37 °C for 36 h. 30 μl aliquots were taken from each well every 10–12 h to measure tumour cells remaining over time. Stably expressed firefly luciferase in the Nalm6-GL cells was used to measure tumour cells remaining. To readout the amount of luciferase activity in each sample, 30 μl of 2× Bright-Glo (Promega) was added to the 30 μl cell aliquots from each samples and incubated for 1 min. After 1 min, firefly luciferase luminescence was measured using a Tecan Infinite M1000 Pro plate reader using the following parameters: 1,000 ms acquisition time, green-1 filter (520–570 nm), 25 °C linear shaking for 10 s. Schematic summary of HEK293T, T cell, and tumour killing co-culture assay was created, in part, using BioRender.

TRUPATH G-protein activation BRET assay

HEK293T cells were plated in human fibronectin-coated 6-well dishes at a density of 1,250,000 cells per well and allowed to adhere and grow for 2–4 h at 37 °C. After ~2-4 h, the cells were transfected 1:1:1:1 with 250 ng of the indicated G-protein PAGER receptor plasmid, 250 ng of the corresponding Gα-RLuc8 TRUPATH plasmid (GαsS-RLuc8, Gαq-RLuc8 or Gα12-RLuc8), 250 ng of Gβ3 TRUPATH plasmid, and 250 ng Gγ9-GFP2 TRUPATH plasmid. For Gαi1 TRUPATH with PAGERGi, a 1:1:1:1 ratio of components using 100 ng of each plasmid was used. Cells were incubated at 37° and transfection was allowed to proceed for ~20–24 h. After transfection, cells from each well were lifted and resuspended in 6 ml of complete DMEM to make an ~200,000 cells per ml single cell suspension, and 100 μl of cell suspension (~20,000 cells) was plated per well in a human fibronectin-coated white, clear bottom 96-well plate in triplicate. Plates were incubated at 37 °C for ~20–24 h. For protease activation of G-protein-PAGERs, cells were treated with 1 μM TEVp for 90 min followed by stimulation with various concentrations of CNO and 10 μM CTZ400a (substrate for TRUPATH assay) for 5 min before reading out BRET. For antigen activation of PAGERG’s, cells were treated with 1 μM mCherry for 15 min followed by stimulation with various concentrations of CNO and 10 μM CTZ400a (for Gαi1 and Gαq TRUPATHs) or 10 μM Prolume Purple (for GαsS and Gα12 TRUPATHs) for 5 min before reading out BRET. BRET was readout using a Tecan Infinite M1000 Pro plate reader using the following parameters: filter 1 magenta (370 to 450 nm), 500 ms integration time; filter 2 green (510 to 540 nm), 500 ms integration time; 25 °C. Data are presented as NET BRET and displayed as scatter plots with variable slope (four parameter) non-linear regression lines.

Lentivirus generation

To generate lentivirus, HEK293T cells were cultured in T25 flasks and transfected at ~70% confluency with 2.5 μg of the pCDH lentiviral transfer vector of interest and packaging plasmids psPAX2 (1.25 μg) and pMD2.g (1.25 μg) with 25 µl PEI (1 mg ml−1; Polysciences). Approximately 72 h post-transfection, the cell medium was collected and centrifuged for 5 min at 300g to remove cell debris. Medium containing lentivirus was used immediately for transduction or was aliquoted into 0.5 ml aliquots, flash-frozen in liquid nitrogen, and stored at –80 °C for later use. Frozen viral aliquots were thawed at 37 °C prior to infection.

HEK293T stable cell line generation

HEK293T cells were plated on six-well human fibronectin-coated plates. When cells reached ~70–90% confluency, cells were transduced with lentivirus for 1–3 days. The cells were then lifted and replated om a T25 flask, and stably expressing cells were selected for in complete DMEM containing 1 μg ml−1 puromycin for at least 1 week. Cells were split and expanded when they reached ~80–90% confluency. Cells were maintained under this puromycin selection until the time of experiments. Construct expression was confirmed by flow cytometry, immunofluorescence imaging, or functional characterization.

Quantification of p-ERK by western blotting

Antigen was added at indicated concentration to HEK 293T cells stably expressing PAGERG. 3 min later, 300 nM of CNO in 500 μl blank DMEM was added to a final concentration of 100 nM, and the cells were incubated for another 3 min. Cells were then lysed with RIPA lysis buffer supplemented with protease and phosphatase inhibitors (50 mM Tris-HCl, pH 7.4, 150 mM NaCl, 1% Triton X-100, 0.5% sodium deoxycholate, 0.1% SDS, 1 mM EDTA, 1× Halt Protease Inhibitor Cocktail from Thermo Scientific, 1× Phosphatase Inhibitor Cocktail from Cell Signaling Technology). After sonication and centrifugation, the lysate supernatants were mixed with 6× Laemmli sample buffer to prepare the sample for western blotting. The membrane was blotted with 1:1,000 dilutions of antibodies for phospho-p44/42 MAPK (phospho-Erk1/2; Cell Signaling Technology 9101), p44/42 MAPK (Erk1/2; Cell Signaling Technology 9107), and β-Tubulin (Cell Signaling Technology 86298).

Fluorescence imaging of PAGER localization and secondary messenger reporters

Confocal imaging was performed on a Zeiss AxioObserver inverted confocal microscope with 10× and 20× air objectives, and 40× and 63× oil-immersion objectives, outfitted with a Yokogawa spinning disk confocal head, a Quad-band notch dichroic mirror (405/488/568/647), and 405 (diode), 491 (DPSS), 561 (DPSS) and 640 nm (diode) lasers (all 50 mW). The following combinations of laser excitation and emission filters were used for various fluorophores: GFP (491 laser excitation; 528/38 emission), mCherry/Alexa Fluor 568 (561 laser excitation; 617/73 emission), Alexa Fluor 647 (647 excitation; 680/30 emission), and differential interference contrast. Acquisition times ranged from 100 to 500 ms. All images were collected using SlideBook (Intelligent Imaging Innovations) and processed using FIJI/ImageJ.

Immunofluorescence staining of PAGER localization

HEK 293T cells expressing the indicated PAGERTF or PAGERG construct were fixed in 4% paraformaldehyde for 10 min at room temperature, followed by membrane permeabilization by treating with 0.5% Triton-X in PBS for 10 min. The cells were then incubated in 0.1% Tween-20 in PBS supplemented with 1% BSA for 30 min for blocking, followed by 1:1,000 anti-ALFA–AlexaFluor647 in blocking buffer for 1 h to stain for PAGER localization. After three washes in 0.1% Tween-20 in PBS, 1 µg ml−1 DAPI in PBS was added as a nuclear marker, and the cells were analysed by confocal microscopy.

Fluorescent DAG assay

An mCherry-based fluorescent DAG biosensor was made by C-terminally tagging mCherry to the C1PKCγ from Addgene plasmid #2120532 and cloning into the pCDH lentivirus backbone. HEK 293T cells stably co-expressing anti-GFP (LaG16) PAGERGq and C1PKCγ-mCherry were incubated in 1:1,000 anti-ALFA–AlexaFluor647 and 1 μM EGFP for 3 min. Cells were then located under the microscope and time-lapse images were obtained every 4 s, and 1 ml of 150 nM CNO was added (to a final concentration of 100 nM) between the first and the second frame. Images at the first time frame (t = 0) and 15th time frame (t = 60 s) were used for analysis.

Images were analysed using FIJI/ImageJ software. Regions of interest (ROIs) were manually added to images and the difference in mean of cytosolic mCherry fluorescence (Δ(F − F0)/F0) in each cell was quantified to plot the time course of C1PKCγ-mCherry signal. Note: cytosolic mCherry fluorescence was used as a readout for the depletion of DAG probe from cytosol upon membrane recruitment.

GCaMP6s calcium assay

A GFP-based fluorescent calcium biosensor was made by cloning GCaMP6s from Addgene plasmid #4075333 into the pCDH lentivirus backbone. HEK 293T cells stably co-expressing anti-mCherry (LaM6) PAGERGq and GCaMP6s were equilibrated in HBSS (Gibco; HBSS, calcium, magnesium, no phenol red) for 10 min at room temperature. Cells were then placed in 500 μl of HBSS (with or without 1 μM mCherry) and located under the microscope. Time-lapse images were obtained every 10 s, and 1 ml of CNO or DCZ was added (to a final concentration of 0.3–100 nM) at t = 30 s.

Images were analysed using FIJI/ImageJ software. ROIs were manually added to images and the difference in mean of cytosolic GFP fluorescence (Δ(F − F0)/F0) in each cell was quantified to plot the time course of GCaMP6s signal. The maximum difference at each DCZ concentration was calculated to obtain dose–response curves.

G-Flamp2 cAMP assay

A GFP-based fluorescent cAMP biosensor was made by cloning G-Flamp2 from Addgene plasmid #19278234 into the pCDH lentivirus backbone. For PAGERGs, HEK 293T cells stably expressing G-Flamp2 and anti-mCherry (LaM6) PAGERGs were equilibrated in HBSS (Gibco; HBSS, calcium, magnesium, no phenol red) for 10 min at room temperature. Cells were then placed in 500 μl of HBSS (with or without 1 μM mCherry) and located under the microscope. Time-lapse images were obtained every 10 s, and 1 ml of CNO or DCZ was added (to a final concentration of 0.3–100 nM) at t = 30 s.

For PAGERGi, HEK 293T cells stably expressing G-Flamp2 and anti-mCherry (LaM6) PAGERGi were equilibrated in HBSS (Gibco; HBSS, calcium, magnesium, no phenol red) for 10 min at room temperature. Cells were then placed in 500 μl of HBSS (with or without 1 μM mCherry) and located under the microscope. Time-lapse images were obtained every 10 s, and 500 μl of 2 μM forskolin was added (to a final concentration of 1 μM) at t = 20 s, followed by 1 ml of CNO or DCZ (to a final concentration of 0.3–100 nM) at t = 120 s.

Images were analysed using FIJI/ImageJ software. ROIs were manually added to images and the difference in mean of cytosolic GFP fluorescence (Δ(F − F0)/F0 for PAGERGs, Δ(F – Fmax)/Fmax for PAGERGi, where Fmax is a maximum signal upon forskolin stimulation) in each cell was quantified to plot the time course of G-Flamp2 signal. The maximum difference at each DCZ concentration was calculated to obtain dose–response curves.

AAV1/2 generation

To generate supernatant AAV, HEK293T cells were cultured in 6-well plate and transfected at approximately 80% confluency in opti-MEM reduced serum medium (Gibco). Per each well, the AAV vector containing the gene of interest (360 ng) and AAV packaging/helper plasmids AAV1 (180 ng), AAV2 (180 ng), and DF6 (720 ng) incubated with 10 μl PEI in 200 μl opti-MEM were used for transfection. After 20 h, the cell medium was replaced with complete DMEM. The cell medium containing the AAV was collected 48 h post transfection and filtered using a 0.45-μm filter. For in vivo expression, AAV1/2 was produced in a large scale (3× 15-cm plates) accordingly and purified using a HiTrap heparin column (GE Healthcare) as previously described56.

GCaMP6s neuronal activity assay

All procedures were approved and carried out in compliance with the Stanford University Administrative Panel on Laboratory Animal Care, and all experiments were performed in accordance with relevant guidelines and regulations. Before dissection, 35 mm glass bottom dishes (CellVis) were coated with 0.001% (w/v) poly-l-ornithine (Sigma-Aldrich) in DPBS (Gibco) at room temperature overnight, washed three times with DPBS, and subsequently coated with 5 μg ml−1 of mouse laminin (Gibco) in DPBS at 37 °C overnight. Cortical neurons were extracted from embryonic day 18 Sprague Dawley rat embryos (Charles River Laboratories, strain 400) by dissociation in Hank’s balanced salt solution with calcium and magnesium (Gibco). Cortical tissue was digested in papain according to the manufacturer’s protocol (Worthington), then 5 × 105 cells were plated onto each dish in neuronal culture medium at 37 °C under 5% CO2. The neuronal culture medium is neurobasal (Gibco) supplemented with 2% (v/v) B27 supplement (Life Technologies), 0.5% (v/v) fetal bovine serum, 1% (v/v) GlutaMAX, 1% (v/v) penicillin-streptomycin, and 1% (v/v) sodium pyruvate (Gibco, 100 mM).

On division 3 and division 6, half of the medium was removed from each dish and replaced with neuronal culture medium. On division 6 after the medium change, each well was infected with 35 μl of AAV1/2 (10 μl of GCaMP6s AAV and 25 μl of anti-mCherry (LaM6) PAGERGi AAV). Neurons were wrapped in aluminum foil and allowed to express in the incubator.

For HEK–neuron coculture experiments, HEK 293T cells were plated in a 6-well plate and transfected with surface mCherry on a day before the imaging. 8 h after transfection, the HEK cells were collected in PBS without using trypsin. The cells were pelleted and resuspended in neuron culture medium supplemented with 2.5 μM cytosine β-d-arabinofuranoside hydrochloride (AraC; Sigma-Aldrich C6645). HEK cells were resuspended at 5 × 105 cells per ml (for 1:2 HEK:neuron co-culture) or 1 × 105 cells per ml (for 1:10 HEK:neuron co-culture). Five-hundred microlitres of the resuspended cells were plated on each neuron-plated imaging dish (2 ml culture medium) to make the final AraC concentration 0.5 μM.

On division 13, cells were preincubated in HBSS for 10 min, and then incubated in 1:1,000 anti-ALFA–AlexaFluor647 and 1 μM mCherry in HBSS for 3 min. Cells were then located under the microscope and time-lapse images were obtained every 1 s, and 1 ml of 50 nM CNO or 3 nM DCZ was added (to a final concentration of 33 nM or 2 nM) at t = 10 s.

Images were analysed using FIJI/ImageJ software. ROIs were manually added to images and the mean of cytosolic GFP fluorescence in each cell was quantified to plot the time course of GCaMP6s signal in the form of Δ(F – Fmin)/(Fmax − Fmin).

Neuronal electrophysiology assay in brain slices

Subjects

Adult female C57BL/6 mice (Jackson Laboratory) were used for slice electrophysiology experiments. All procedures were carried out in accordance with the National Institutes of Health guidelines for animal care and use, and were approved by the Administrative Panel on Laboratory Animal Care of Stanford University (protocol 30183). Mice were group housed (2–5 per cage), received ad libitum access to food and water, and were maintained on a 12 h light/dark cycle throughout the study under standard housing conditions (21 ± 2 °C; 50 ± 15% humidity).

Slice electrophysiology

Mice received a stereotaxic injection bilaterally into CA1 (M/L: ±1.5; A/P: −2.3; D/V: −1.35 mm) when 4–8 weeks old of 400 nL AAV1/2 vector containing an hSyn-α-mCherry-PAGER-Gi-P2A-mEGFP expression cassette (1.9 × 1013 genome copies (GC) ml−1). At 3–6 weeks following initial injection, mice were deeply anaesthetized by ketamine/xylazine and then transcardially perfused with an ice-cold protective recovery solution containing (in mM): 92 N-methyl-d-glucamine (NMDG), 26 NaHCO3, 25 glucose, 20 HEPES, 10 MgSO4, 5 sodium ascorbate, 3 sodium pyruvate, 2.5 KCl, 2 thiourea, 1.25 NaH2PO4, 0.5 CaCl2, titrated to a pH of 7.3–7.4 with HCl57. Hippocampus-containing coronal brain slices (250 µm) were cut in ice-cold protective recovery solution using a vibratome (VT1200S, Leica Biosystems) and then incubated in 35 °C protective recovery solution for 12 min. Subsequently, brain slices were maintained in room temperature artificial cerebrospinal fluid (aCSF) consisting of (in mM): 126 NaCl, 26 NaHCO3, 10 glucose, 2.5 KCl, 2 MgCl2, 2 CaCl2, 1.25 NaH2PO4. All solutions were equilibrated with 95% O2/5% CO2.

Intracellular recordings were performed in a submerged chamber perfused with oxygenated aCSF at 3 ml min−1 and maintained at 33 °C by a chamber heater (BadController V, Luigs and Neumann). CA1 neurons were visualized using differential interference contrast illumination on an Olympus BX61WI microscope (Olympus Microscopy) with an sCMOS camera (Flash 4.0 LT+, Hamamatsu). Epifluorescence illumination from an LED lamp (Solis-3C, Thorlabs) was used to identify GFP-positive transfected neurons. Recording pipettes were pulled from thin-walled borosilicate capillary glass (King Precision Glass) using a P97 puller (Sutter Instruments) and were filled with (in mM): 126 potassium gluconate, 10 HEPES, 4 KCl, 4 ATP-Mg, 0.3 GTP-Na, 10 phosphocreatine (pH-adjusted to 7.3 with KOH, osmolarity 290 mOsm), as well as 0.2% biocytin. Pipettes had a 3–5 MΩ tip resistance.

Whole-cell recordings were performed on GFP-positive CA1 neurons in the dorsal hippocampus (A/P: −1.7–2.6 mm). Pipette capacitance was neutralized for all recordings and holding current was adjusted so that all cells began recordings with an initial membrane potential of −65 mV. Neuronal properties were assessed longitudinally, across 5 s sweeps, featuring repeated current injection patterns including a brief hyperpolarizing current step (−100 pA, 200 ms), followed shortly later (300 ms) by a linearly ramping current delivery (−150 to +500 pA, across 2 s). Input resistance (Rin) was calculated from the change in steady-state membrane potential resulting from hyperpolarizing current injections. RMP was measured as the average value during the period (500 ms) in each sweep prior to any current injection. All action potentials were counted during the ramping current delivery and the rheobase value was the current being delivered when the first action potential of each sweep was evoked.

At the end of recordings, brain slices were fixed in 4% paraformaldehyde with 0.2% picric acid in 0.1 M phosphate buffer for 24 h at 4 °C. Biocytin-filled neurons were labelled by washing sections in PBS, permeabilizing with 0.5% Triton X-100 (Sigma-Aldrich) in TBS and then overnight incubation at 4 °C in Alexa Fluor 405-conjugated streptavidin (1:1,000, Molecular Probes). Sections were then washed and mounted in Vectashield (Vector Laboratories), before collecting z-stack images of the biocytin and mEGFP signals in the hippocampus using a Zeiss LSM 710 confocal microscope using a 20× 0.8 NA objective.

Data were excluded from cells where the initial Rin was >500 mΩ, as well as individual sweeps where the RMP was >−50 mV or where no action potentials were detected. Responses were tracked during bath application of DCZ (100 nm, Tocris) or the same dose of DCZ combined with soluble mCherry (1 µM). All cells recorded with DCZ + mCherry also underwent a prior preincubation in mCherry (1 µM; range: 30–150 min, mean: 73.4 min). Recordings in DCZ alone were avoided after >1 DCZ + mCherry experiment per day to reduce potential cross contamination. Data were collected from n = 15 cells, 7 mice with DCZ, n = 26 cell, 6 mice DCZ + mCherry. Recordings were only performed in brain slices naïve to prior DCZ exposures. Data were acquired in pClamp software (Molecular Devices) using a Multiclamp 700B amplifier (Molecular Devices), low-pass filtered at 2 kHz, and digitized at 10 kHz (Digidata 1440 A, Molecular Devices). Data analysis was performed using custom written Python scripts.

Statistical analysis

Graphs and statistical analyses were generated using Python (with Pandas, Seaborn, Scipy and Statsmodels packages). To account for the nested data produced in whole-cell electrophysiology experiments where multiple cells are recorded from each animal, differences between treatment groups were evaluated by a mixed linear model regression analysis58. Sex was not considered in the current study design and a sex-based analysis was not performed, with our current data being restricted entirely to female samples. Analysis of neuronal responses was conducted blinded to treatment groups.

Lentiviral transduction of primary human T cells

On day 0, primary human T cells were thawed and activated with anti-CD3/CD28 human T-Expander Dynabeads (Thermo Fisher Scientific) at a 1:1 bead to cell ratio. On day 2, 1 ml of 500,000 cells per ml T cell suspension was added to each well of a 24-well non-tissue culture treated plate. To each well, 1.6 µl of 10 mg ml−1 polybrene (for 8 µg ml−1 in 2 ml final) was added to each well. One millilitre of lentivirus was added per well. Plates with T cell/virus mixes were spun at 1,000g for 2 h at 32 °C in an aerosol tight plate holder. After the 2 h spin, cells were resuspended, moved to 6-well plates, and incubated for 24 h at 37 °C under 5% CO2. On day 4, Dynabeads were removed by magnetic separation and lentivirus was removed by centrifugation. Cells were maintained between 0.4 × 106 and 2 × 106 cells per ml and expanded until day 11–12. On day 11-12, PAGER-expressing T cells were enriched by magnetic-activated cell sorting (MACS; using an ALFA–biotin antibody (NanoTag) and ALFA–biotin antibody (NanoTagbiotin microbeads (Miltenyi)) or by fluorescent-activated cell sorting (FACS; using ALFA-647 antibody (NanoTag)). Typically, enriched T cells were >95% PAGER+ . PAGER+ T cells were used for experiments on days 14–19.

T cell migration assays

In a 96-well Transwell plate (3 μm pore size; Corning), 80 μl of 1.25 × 106 PAGER + T cells ml−1 ( ~ 100,000 cells) were plated in the top chamber. T cells were let to settle for 1 h at 37 °C under 5% CO2. After 1 h, 0.8 μl 100 nM DCZ was added to the top chamber of each well and 240 μl of medium containing 1 nM DCZ and cognate (10 μM mCherry) or non-cognate (10 μM GFP) antigen was added to the bottom chamber of each well. This way, the DCZ concentration was equal across the entire well (that is, no DCZ gradient formed) and only a gradient of antigen (mCherry or GFP) was formed over time. T cells were incubated at 37 °C under 5% CO2 for 2 h to let chemotaxis migration to occur. For experiments where pertussis toxin (PTX) was used to assess the role of Gi activation in PAGER-mediated chemotaxis, after PAGER+ T cells were added to the top chamber of each well, 1 μl of 16 μg ml−1 PTX was added to the cells (final 200 ng ml−1 PTX) and let incubate at 37 °C under 5% CO2 for 3 h before adding DCZ/antigen-containing medium in the bottom chambers. For time course experiments, separate wells were set up for each time point and DCZ/antigen-containing medium was added to the bottom chambers at different times so all wells could be collected together.

After incubation for 2 h to allow for chemotaxis, T cells that migrated from the top chamber, across the porous membrane, to the bottom chamber were collected; all of the medium in the bottom chamber (~240 μl) was moved to wells of a 96-well v-bottom plate and the centrifuged in swinging bucket rotor at 1,000g for 5 min. Medium in the wells was removed by flicking off and dabbing excess on paper towel. One-hundred microlitres DPBS was added to each well of the 96-well v-bottom plate and pipetted up and down 10 times to resuspend any potential T cells in the wells. This cell suspension was then moved to a white 96-well solid-bottom plate where CellTiter-Glo 2.0 was used to create a luminescent signal proportional to the number of T cells present. 100 μl of CellTiter-Glo 2.0 was added to each well and mixed by hand for 1 min, let incubate for 10 min at room temperature in the dark, and then luminescence was measured using a Tecan Infinite M1000 Pro plate reader using the following parameters: 1,000 ms acquisition time, green-1 filter (520–570 nm), 25 °C linear shaking for 10 s. Schematic summary of T cell migration assay was created, in part, using BioRender.

The development of GRABDCZ sensors

We chose human M4R as the sensor scaffold and embarked on a systematic optimization process. This process included screening and optimizing the insertion sites, the amino acid composition of the linker, and the critical residues in cpEGFP to enhance the maximum response and fluorescence of sensors. Subsequently, specific DCZ sensors were developed by introducing binding pocket mutations based on these sensors.

  • ICL3 replacement: we replaced the ICL3–cpEGFP of the previously developed GRABgACh sensor1 with the corresponding ICL3 of hM4R. A replacement library was generated using 9 sites (S5.62 to H5.70) from the N terminus and 5 sites (T6.34 to F6.38) from the C terminus. After screening, we created a prototype ACh sensor named hM4-0.1, which exhibited a 100% ΔF/F fluorescence response to 100 μM ACh. The replacement sites of hM4-0.1 are located between R5.66 and T6.36 in hH4R.

  • Linker optimization: the amino acid composition of the linker was found to be critical to the sensor’s dynamic range. We performed site-saturation mutagenesis on 6 residues of the linker. Through this process, we identified a variant named hM4-0.5, with an R5.66 L mutation, which resulted in a ~ 130% increase in ΔF/F0.

  • cpEGFP optimization: building on our screening experience in developing GRAB sensors2,3, we selected four residues in the cpEGFP for individual randomizations. This led to the development of the hM4-1.0 sensor with an H18I mutation, showing a maximal response of ~350% to 100 μM ACh.

  • Binding pocket mutations: to develop specific DCZ sensors, we introduced Y3.33 C and A5.46 G mutations11,59 based on the hM4-1.0, resulting in the creation of DCZ1.0, which exhibited a ~150% response to 1 μM DCZ.

Fluorescence imaging of GRAB sensors and PAGERFL

The Opera Phenix high-content screening system (PerkinElmer) was utilized for GRAB sensors and PAGERFL imaging, equipped with a 20× 0.4-NA objective, a 40× 0.6-NA objective, a 40× 1.15-NA water-immersion objective, a 488-nm laser, and a 561-nm laser. GFP and RFP signals were collected using a 525/50 nm emission filter and a 600/30 nm emission filter, respectively. HEK293T cells expressing GRABDCZ1.0 or PAGERFL were imaged before and after adding specified DCZ/antigens while being bathed in Tyrode’s solution. The change in fluorescence intensity of GRABDCZ1.0 was determined by calculating the change in the GFP/RFP ratio and expressed as ΔF/F0. F0 is the intensity of sensors in the basal (no DCZ/antigen) condition.

Mini G-protein luciferase complementation assay

HEK293T cells were cultured in 6-well plates until they reached 60–70% confluence. At this point, the specified wild-type receptor or sensor, along with the corresponding LgBit-mGi construct, were co-transfected into the cells. Around 24–36 h post-transfection, the cells were detached using a cell scraper, suspended in PBS, and then transferred to 96-well plates (white with a clear flat bottom) containing Nano-Glo Luciferase Assay Reagent (Promega) diluted 1,000-fold in PBS at room temperature. Following this, solutions with varying DCZ concentrations and 1 μM antigens were added to the wells. After a 10-min reaction in the dark at room temperature, luminescence was measured using a VICTOR X5 multi-label plate reader (PerkinElmer).

Quantification and Data Analysis

All graphs were created using GraphPad Prism 9 or matplotlib (Python). Error bars represent s.d. unless otherwise noted. For scatter plots, variable slope (four parameter) non-linear regression lines were used. For comparison between two groups, P values were determined using two-tailed Student’s t-tests. For multiple comparisons, P values were determined using two-way ANOVA with Tukey’s multiple comparisons test to adjust for multiple comparisons. *P < 0.05; **P < 0.01; ***P < 0.001; ****P < 0.0001; NS, not significant.

General guidelines for designing and validating PAGERs

A workflow for developing and optimizing new PAGERs is outlined below. These steps are generally the same no matter which type of PAGER (PAGERTF, PAGERG, or PAGERFL) is being developed, but specific notes and tips for the creation of different types of PAGERs are also included.

Choosing an antigen binding domain

The specificity and sensitivity of a given PAGER is primarily determined by the antigen binding domain that is used. If available, we recommend using a nanobody for the antigen binding domain, as we have had the most success building functional PAGERs with this class of binder; ~50% of all nanobodies tested resulted in functional PAGERs. Other binding domains that have their N terminus proximal to the binding interface may also work. When possible, we suggest starting with 2–3 high-affinity binders against your antigen of interest to test in PAGER, as the affinity of binders for antigen in the context of PAGER may be different (oftentimes lower) than their published affinities.

Construct design

The relative position of the binder and the antagonist is critical. The antagonist should be fused directly to the N terminus of the binder (no linker between). This is because proximity of the antagonist to the CDR loops of the binder creates the steric occlusion of the antagonist upon antigen binding that is necessary for PAGER activation. Even short linkers between the antagonist and binder may make PAGER insensitive to soluble antigen. In our constructs, we also typically omit the first 2–3 amino acids of the nanobody (for example, MAQ) so as to place the antagonist as near to the nanobody CDRs as possible.

The linker between the binder and the GPCR is less critical but needs to be sufficiently long to allow the antagonist to reach the GPCR active site. This linker is also a convenient location to insert an epitope tag to detect PAGER expression. We generally use ALFA tag due to its small size and non-perturbative helical structure. Importantly, we highly recommend including a TEVcs (ENLYFQ/S) in this linker, as it is useful for assessing antagonism in newly generated PAGER constructs (described in step 3 below).

Signal peptides are included in all PAGER constructs to promote surface expression of the receptor. For PAGERG and PAGERFL, we use the native signal peptide of muscarinic toxin. PAGERTF requires a signal peptide that does not leave any residues on the N terminus of the antagonist (that is, no P′ residues in the cleavage sequence of the signal peptide), as the N-terminal residues of the arodyn peptide antagonist in PAGERTF are essential for peptide binding and antagonism. All PAGERTF constructs we developed utilize an IL-2 signal peptide, which does not leave an N-terminal scar, but other scarless signal peptides could also be used.

Screening for expression, localization, and reversible auto-inhibition

We recommend first screening candidate PAGERs in HEK293T cells before moving to other cell types of interest. We have found that PAGER expression, surface localization, and antagonism are the key features that determine overall PAGER functionality. To assess all these aspects simultaneously, we devised a screen using recombinant TEVp and the extracellular TEVcs discussed in step 2 above. In this approach, a dose–response curve of PAGER agonist (SalB for PAGERTF or DCZ/CNO for PAGERG/PAGERFL) should be conducted with and without pretreatment with recombinant TEVp (we typically pretreat PAGER-expressing cells with 1 μM TEV for 90 min, but as little as 30 min is also sufficient). In the absence of TEVp, a dose-dependent activation of PAGER should be observed, as increasing concentrations of agonist will outcompete the fused antagonist and activate the receptor; this alone confirms whether the PAGER is expressed and activatable. With TEVp pretreatment, the antagonist should be cleaved, sensitizing the PAGER to the agonist, and result in the dose–response curve shifting to the left; this confirms surface localization (since the recombinant TEVp can only act on plasma membrane localized PAGERs) and reversible antagonism. As further validation, immunofluorescence and flow cytometry should be conducted to confirm PAGER expression and surface localization.

In our experience, any PAGER that fails this TEV test (that is, does not show a clear dose–response curve with a leftward shift upon TEVp pretreatment) has also been unresponsive to antigen. Furthermore, 83% of PAGERs that passed this test went on to be responsive to antigen. Therefore, this screen is a simple intermediate step to save time and resources by narrowing the list of candidate PAGERs to those with a high likelihood of success prior to antigen screening.

Screening for response to antigen

PAGERs that pass the TEVp screen should then be tested using the target antigen. The agonist concentration that yielded the highest signal:noise in the TEV screen (+TEV/–TEV) should be used for antigen testing. We generally recommend performing antigen dose–response curves to determine the overall affinity and sensitivity of each PAGER to the antigen of interest.

Ideally, you might have multiple PAGERs that respond to your antigen of interest. In this case, it is important to consider your downstream application when choosing which PAGER to move forward with. PAGERs with higher affinity binders offer higher sensitivity to the antigen but may also exhibit slow or irreversible antigen binding, while PAGERs with lower-affinity binders typically provide lower sensitivity but higher reversibility, enabling activation only during coincidence detection of antigen and agonist (Sal B or DCZ/CNO). The concentration of antigen that you wish to detect using PAGER should also be considered; to detect higher concentrations of antigen, a low sensitivity PAGER may suffice, but to detect lower concentrations of antigen, a high sensitivity PAGER may be required. All these factors should guide the selection of a PAGER with characteristics best suited for the user’s downstream applications.

Optimization of PAGER expression in a cell type of interest

In our studies, choosing the right promoter for the target cell type was a key factor for successful PAGER expression. For example, CMV promoter worked best in HEK 293T cells while SFFV promoter worked best for T cells. The expression and delivery method also depend on the target cell type. Expression methods commonly used for your cell type of interest are a good starting point, but testing multiple approaches is likely to help identify the best method for optimal PAGER expression. Of note, the larger size of PAGERTF compared to PAGERG or PAGERFL (~3 kb vs ~2 kb) and the two additional gene components of PAGERTF (the arrestin–TEVp and the transcriptional response element) require co-transduction of two or three viruses into the target cells. Combining two PAGERTF components into a single lentivirus may facilitate the reconstitution of all components by requiring one less virus to be co-transduced. As with other multiple component systems, proper relative expression of the components needs to be achieved and often needs to be determined empirically.

Reporting summary

Further information on research design is available in the Nature Portfolio Reporting Summary linked to this article.

RELATED ARTICLES

Most Popular

Recent Comments