Saturday, May 23, 2026
No menu items!
HomeNatureReprogramming neuroblastoma by diet-enhanced polyamine depletion

Reprogramming neuroblastoma by diet-enhanced polyamine depletion

Primary neuroblastoma patient samples

Flash-frozen primary neuroblastoma tumour samples were provided by the Children’s Oncology Group (COG) under study number ANBL16B2 Q. International Neuroblastoma Pathology Classification histologic parameters, MYCN amplification status, age and stage for every patient was obtained centrally via the COG Statistics and Data Center. Tumour cell content of samples was confirmed over 80% percent. Patient and tumour characteristics are given in Supplementary Table 1. Water-soluble metabolites were extracted and analysed as described below.

Mouse models

Animal studies followed protocols approved by Princeton University and Children’s Hospital of Philadelphia Institutional Animal Care and Use Committees. For xenografts used for metabolomics, cancer cell lines were grown in RPMI supplemented with 10% FBS and 0.01% insulin/transferrin solution. Cell lines were provided by the COG Cell Culture Repository: LA-N-5, SMS-SAN, CHLA-90 and SK-N-SH. All cell lines repeatedly tested negative for Mycoplasma. Subcutaneous xenografts were established on 6-week-old female CD1-nu mice by injection of 100 μl 50/50 RPMI/Matrigel solution containing 106 cells of the respective cell line. For xenografts used in therapeutic trials, tumours were established on 4- to 6-week-old female NCr-nu mice (Charles River) by injection of 100 μl 50/50 RPMI/Matrigel solution containing 3 × 106 IMR5 cells (MYCN amplified, ALK amplified). Mice were randomized to specific treatment when tumours were ≥200 mm3. Mice were sacrificed when tumours were 2,000 mm3. Tumour mass was inferred using tumour volume using volume to mass of xenograft conversion described in McLean et al.58. The Th-MYCN mouse model was used to investigate the functional changes of metabolism driven by MYCN. 129×1/SvJ mice transgenic for the Th-MYCN construct10 were originally obtained from B. Weiss. Th-MYCN hemizygous mice were bred and litters randomized to assigned therapy. Mice were genotyped from tail-snip-isolated DNA using quantitative PCR23 and only transgene-homozygous mice (Th-MYCN+/+) were included in these studies. In this model, MYCN expression is targeted to the mouse neural crest under the tyrosine hydroxylase promoter, recapitulating hallmark features of human neuroblastoma. Tumours arise at autochthonous sites in an immunocompetent host with histologic, genomic, and immune similarities to human neuroblastoma59,60. Tumours are fully penetrant with onset prior to day 14 in >75% based on histologic audits61 and are lethal by 7 weeks.

Mouse husbandry

Mice were maintained with 12 h of dark daily (18:00 to 06:00). The rodent holding rooms were maintained at a temperature range of 18.9 °C–25.6 °C with an ideal setpoint of 22.2 °C. The humidity was maintained within a range of 30–70% with an ideal setpoint of 50%.

Metabolite extraction from tissue, tumours and serum

Tissues and tumours were collected from mice in fed state and immediately clamped into liquid nitrogen using Wollenberger clamp. All tissues were stored in −80 °C. Frozen tissues were transferred to 2 ml Eppendorf tubes, which were precooled on dry ice, and then pulverized using Cyromill. The resulting tissue powder was weighed (around 10 mg) and mixed well by vortexing in extraction buffer (40 μl extraction buffer per mg tissue). The extraction solution was neutralized with NH4HCO3 as above and centrifuged in a microfuge at maximum speed for 30 min at 4 °C. Supernatant was transferred to LC–MS vials for analysis. Blood samples were drawn from mouse tail veins using a microvette and kept on ice. After centrifugation (10 min, benchtop microfuge maximum speed, 4 °C), serum was collected in a 1.5 ml tube and stored at −80 °C. Five microlitres of serum were mixed with 200 μl extraction buffer (40:40:20 acetonitrile: methanol: water with 0.5% formic acid) and neutralized with 15% NH4HCO3. After centrifugation (30 min, benchtop microfuge maximum speed, 4 °C), supernatant was transferred to LC–MS vials for analysis.

Metabolite measurement by LC–MS/MS

Metabolomics was performed on the following systems. A quadrupole-orbitrap mass spectrometer (Q Exactive, Thermo Fisher Scientific), operating in positive or negative mode was coupled to hydrophilic interaction chromatography (HILIC) via electrospray ionization18. Scans were performed from m/z 70 to 1,000 at 1 Hz and 140,000 resolution. Liquid chromatography separation was on a XBridge BEH Amide column using a gradient of solvent A (20 mM ammonium acetate, 20 mM ammounium hydroxide in 95:5 water:acetonitrile, pH 9.45) and solvent B (acetonitrile). Flow rate was 150 μl min−1. The liquid chromatography gradient was: 0 min, 85% B; 2 min, 85% B; 3 min, 80% B; 5 min, 80% B; 6 min, 75% B; 7 min, 75% B; 8 min, 70% B; 9 min, 70% B; 10 min, 50% B; 12 min, 50% B; 13 min, 25% B; 16 min, 25% B; 18 min, 0% B; 23 min, 0% B; 24 min, 85% B. Autosampler temperature was 5 °C, and injection volume was 5–10 μl. Complementary, primary samples analysed on an Exactive (Thermo Fisher Scientifc) operating in negative ion mode62. Liquid chromatography separation was achieved on a Synergy Hydro-RP column (100 mm × 2 mm, 2.5 μm particle size, Phenomenex), using reversed-phase chromatography with the ion pairing agent tributylamine in the aqueous mobile phase to enhance retention and separation. An adaptive scan range was used with an m/z from 85–1,000. Resolution was 100,000 at 1 Hz. The total run time was 25 min with a flow rate at 200 μl min−1. Solvent A is 97:3 water/methanol with 10 mM tributylamine and 15 mM acetic acid; solvent B is methanol. The gradient is 0 min, 0% B; 2.5 min, 0% B; 5 min, 20% B; 7.5 min, 20% B; 13 min, 55% B; 15.5 min, 95% B; 18.5 min, 95% B; 19 min, 0% B; 25 min, 0% B.

Mass spectrometry analysis

Metabolomics data analysis was performed using ElMaven software (https://github.com/ElucidataInc/ElMaven). For labelling experiments, correction for natural abundance of 13C was performed using Accucor (https://github.com/XiaoyangSu/AccuCor).

Infusion studies and isotope tracing in Th-MYCN mice

Th-MYCN mice were housed in groups and food was supplied without restriction to guarantee sufficient supply. Mice weights were recorded every day. During experiments mice were freely moving and tissues and serum were analysed following the above-mentioned method. Tumour and inter organ cooperativity in proline, arginine and ornithine biosynthesis was analysed on the whole-body level. The mice were on normal light cycle (06:00–18:00). In vivo infusion was performed on 6- to 7-week-old normal Th-MYCN mice pre-catheterized in the right jugular vein and 13C metabolite tracers were infused for 2.5–5 h to achieve isotopic pseudo-steady state. The mouse infusion setup included a tether and swivel system, connecting to the button pre-implanted under the back skin of mice. Mice were fasted from 09:00 to 14:00 and infused from 14:00 to 16:30. Tracers were dissolved in saline and infused via the catheter at a constant rate (0.1 μl min−1 per g mouse weight) using a Just infusion Syringe Pump. One-hundred millimolar [U-13C]glutamine was dissolved and infused for 2.5 h, 40 mM [U-13C]arginine was infused for 5 h, 200 mM [U-13C]glucose was infused for 5 h, 10 mM [U-13C]proline for was infused 5 h and 5 mM [U-13C]ornithine was infused for 5 h. At the end of infusion, mice were dissected and tissues were clamped in aluminium foil and stored in liquid nitrogen.

Intervention study in Th-MYCN mice

ArgPro-free diet was purchased from TestDiet Baker (1812426 (5CC7) for CD, 1816284-203 (5WYF) for ProArg-free diet, 1819015-203 (5WZ3) for arginine-free diet and 1816284-203 (5BDL) for proline-free diet). Detailed makeup is given in Supplementary Table 2. The ODC inhibitor, DFMO, was obtained from P. Woster. DFMO was dissolved in drinking water and supplied to mice ad libitum at a dose of 1% in the drinking water. Survival end point: only Th-MYCN+/+ mice were randomized. DFMO was provided to mothers on day 1 (partially transmitted to pups in breastmilk) and then directly to pups at day 28 of life, post-weaning; diet change was started at day 21 of life, per treatment assignment. Mice were weighed and assessed for tumour growth and symptoms, at least thrice weekly by a single experienced animal technician. Mice were euthanized at pre-defined humane endpoints related to overall health or tumour burden (hunching, immobility, hindlimb paresis, weight loss or respiratory distress). An additional ‘late start’ trial was done with Th-MYCN+/+ mice enrolled at the time of a palpable progressing abdominal tumour (typically day of life 35–50), randomized to diet and/or DFMO as above, and taken down for tumour mass after 14 days of therapy, sooner if humane endpoints were reached. For metabolomics studies. Th-MYCN+/+ mice were treated as above, serum was obtained at day 43 (±2 days) and tumours and organs were collected at that time if tumour was present or delayed to the earliest time tumour became palpable. Time to tumour collection depended on the treatment group. In order to ensure homogenous timing of metabolic tumour collection, Th-MYCN+/+ mice ProArg-free diet plus DFMO had therapy delayed to day 28.

Intervention study in human xenografts

Mice bearing established IMR5 xenografts at ≥200 mm3 were randomized to diets and/or DFMO as above. Mice were weighed and assessed for tumour volume and symptoms, at least thrice weekly. End point: mice were euthanized when tumour volume >2 cm3 using calipers measurements and assuming an ellipsoid volume.

Polyamine quantification

Polyamine concentrations and amino acids in the single-amino-acid trials (Pro-free and Arg-free) were quantified using the AccQ-Tag fluorescence dye (Waters) as described63. Derivatives were separated on an Acquity BEH C18 column (150 mm×2.1 mm, 1.7 μm, Waters) by reverse phase UPLC (Acquity H-class UPLC system, Acquity FLR detector, Waters). The column was equilibrated with buffer A (140 mM sodium acetate pH 6.3, 7 mM triethanolamine) at a flow rate of 0.45 ml min−1 and heated at 42 °C. Pure acetonitrile served as buffer B. The gradient was produced by the following concentration changes: 1 min 8% B, 7 min 9% B, 7.3 min 15% B, 12.2 min 18% B, 13.1 min 41% B, 15.1 min 80% B, hold for 2.2 min, and return to 8% B in 1.7 min. Chromatograms were recorded and processed with the Empower3 software (Waters). For acetylated polyamines a MS/MS method was used. In brief, a Waters Acquity I-class Plus UPLC system (Binary Solvent Manager, thermostatic Column Manager and FTN Sample Manager) (Waters) coupled to an QTRAP 6500+ (Sciex) mass spectrometer with electrospray ionization (ESI) source was used. Data acquisition was performed with Analyst (Sciex), and data quantification was performed with the SciexOS software suite (Sciex). Chromatography was made on an Acquity HSS T3 column (150 mm × 2.1 mm, 1.7 μm, Waters) kept at 20 °C and a flow rate of 0.3 ml min−1. Eluent A consisted of water with 0.1% formic acid and eluent B in acetonitrile with 0.1% formic acid. Gradient elution consisted in changing %B as follows: 0–1 min 0%; 5 min 20%; 5.5–7.5 min 100%, and 8–10 min 0%. The ion source settings were as follow: curtain gas: 30 psi; collision gas: low; ion spray: 4,500 V; source temperature: 500 °C; ion source gas 1: 40 (GS1) and ion source gas 2: 50 (GS2). All compounds were measured in positive electrospray ion mode. To ensure comparability of amino acid levels the signal intensity was scaled based on samples that were in parallel analysed by LC–MS.

Detection of labelled polyamines in serum and mouse tissues

For fate tracing of 13C-labelled amino acids into polyamines an ice-cold extraction solvent consisting of 0.1 M HCl plus 10 μM Norleucine (internal standard) was added as follows: 45 μl for 5 μl of serum and 300 μl for 20–30 mg of mouse tissue. After a 15-min incubation on ice, samples were vortexed and centrifuged at 14,000 rpm for 5 min at 4 °C. The supernatants were then labelled with the fluorescence dye AccQ-Tag (Waters) according to the manufacturer’s protocol, with a modification for serum samples where the final volume was adjusted to 120 μl instead of 500 μl. The method used an I-class UPLC system coupled to a QTRAP 6500+ mass spectrometry system (AB SCIEX) with an electrospray ionization (ESI) source. The derivatives were separated using an Acquity HSS T3 column (100 mm × 2.1 mm, 1.8 µm, Waters) maintained at 40 °C. The mobile phases were: A, 0.1% formic acid in water; and B, 0.1% formic acid in acetonitrile. The mass spectrometer was operated in positive-ion mode with an ion spray voltage of 5,500 V, a source temperature of 550 °C, and GS1 and GS2 set at 70. Data acquisition was performed using Analyst 1.7.2 (AB SCIEX).

Polyamine concentration uptake inhibitor AMXT

Polyamine concentration were compared to AMXT1501 treated Th-MYCN tumours from Gamble et al.24.

Metabolomics and MYCN transcriptional activity in 180 cancer cell lines

Metabolomics data for 180 cancer cell lines was obtained from Cherkaoui et al.64. Associations between metabolite levels in core metabolic pathways and MYCN transcriptional activity were obtained from https://cancer-metabolomics.azurewebsites.net/page2.

Gene-expression analysis in neuroblastoma tumours

Gene-expression profiles of 649 neuroblastoma tumours65 were obtained from R2 (R2 Genomics Analysis and Visualization Platform; http://r2.amc.nl). Differential expression analysis between MYCN amplification status was performed using the Bioconductor package limma66 (v.3.40.6).

Gene-expression analysis in neuroblastoma cell lines

Expression profiles of 39 neuroblastoma cell lines67 were obtained from Gene Expression Omnibus. Differential analysis was performed using the Bioconductor package limma (v.3.40.6) and by comparing MYCN amplification status provided in the study. Data from the CCLE68 was taken from the release from the second quarter of 2021 (21Q2).

RNA and ribosome sequencing

Isolation of total RNA, library preparation and sequencing

Total RNA was isolated from the same extracts that were used to obtain mRNA protected fragments (RPFs) (‘Ribo-seq of Th-MYCN tumours’). Three volumes of QIAzol (Qiagen, 79306) were added to 80 μl of cell extracts, mixed thoroughly and proceed to RNA purification with Direct-Zol RNA Mini Prep Plus kit. RNA were sent to Genomic Platform (UNIGE) for stranded mRNA libraries preparation. Libraries were sequenced on an Illumina NovaSeq 6000, SR 100 bp, 10 libraries in 1 pool.

Ribo-seq of Th-MYCN tumours

Mouse tumours were mechanically disrupted in liquid nitrogen and homogenized in a lysis buffer (LB, 50 mM Tris, pH 7.4, 100 mM KCl, 1.5 mM MgCl2, 1.0% Triton X-100, 0.5% sodium deoxycholate, 25 U ml−1 Turbo DNase I, 1 mM DTT, 100 μg ml−1 cycloheximide, and protease inhibitors) 3 ml of LB per 1 g of tissue. To obtain ribosome footprints 0.12 ml of total extracts containing 300 μg of total RNA were treated with RNAse I (Epicentre) (25 U per mg of total RNA), for 45 min at 20 °C with slow agitation. 10 ml SUPERaseIn RNase inhibitor was added to stop nuclease digestion. Monosomes were isolated using S-400 columns. For isolation of RPFs, 3 volumes of QIAzol were added to the S-400 eluate, mixed thoroughly and proceed to RNA purification with Direct-Zol RNA Mini Prep Plus kit.

RPF libraries were prepared as described69,70. In brief, RPFs (25–34 nucleotides) were size-selected by electrophoresis using 15% TBE–Urea polyacrylamide gel electrophoresis (PAGE) and two RNA markers, 25-mer (5′-AUGUACACGGAGUCGAGCACCCGCA-3′) and 34-mer (5′-AUGUACACGGAGUCGAGCACCCGCAACGCGAAUG-3′). After dephosphorylation with T4 Polynucleotide Kinase (NEB, M0201S) the adapter Linker-1 (5′-rAppCTGTAGGCACCATCAAT/3ddC/-3′) was ligated to the 3′ end of the RPF using T4 RNA Ligase 2. Ligated products were purified using 10% TBE–Urea PAGE. Ribosomal RNA was subtracted using RiboCop rRNA Depletion Kit V2 H/M/R. The adapter Linker-1 was used for priming reverse transcription with the reverse transcription primer Ni-Ni-9 (5′-AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTAGATCTCGGTGGTCGC5CACTCA5TTCAGACGTGTGCTCTTCCGATCTATTGATGGTGCCTACAG-3′) using ProtoScript II Reverse Transcriptase. Reverse transcription products were purified using 10% TBE–Urea PAGE. The cDNA was circularized with CircLigase II ssDNA Ligase. The final libraries were generated by PCR using forward index primer NI-N-2 (5′-AATGATACGGCGACCACCGAGATCTACAC-3′) and one of the reverse index primers. Amplified libraries were purified using 8% TBE-PAGE and analysed by Qubit and TapeStation. Libraries were sequenced on an Illumina NovaSeq 6000, SR 100 bp, 4 libraries in 1 pool.

RNA-seq mapping

Fastq files were adaptor stripped using cutadapt with a minimum length of 15 and a quality cut-off of 2 (parameters: -a CTGTAGGCACCATCAAT –minimum-length = 15 –quality-cutoff = 2). Resulting reads were mapped, using default parameters, with HISAT271, using a GRCm38, release 101 genome and index. Differential expression analysis was performed using DESeq272, using a GRCm38, release 101 genome and index.

Ribo-seq mapping

Fastq files were adaptor stripped using cutadapt. Only trimmed reads were retained, with a minimum length of 15 and a quality cut-off of 2 (parameters: -a CTGTAGGCACCATCAAT – trimmed-only –minimum-length = 15 –quality-cutoff = 2). Histograms were produced of ribosome footprint lengths and reads were retained if the trimmed size was 28 or 29 nucleotides. Resulting reads were mapped, using default parameters, with HISAT271 using a GRCm38, release 101 genome and index and were removed if they mapped to rRNA or tRNA according to GRCm38 RepeatMasker definitions from UCSC. A full set of transcripts and coding sequence (CDS) sequences for Ensembl release 101 was then established. Only canonical transcripts (defined by known canonical table, downloaded from UCSC) were retained with their corresponding CDS. Reads were then mapped to the canonical transcriptome with bowtie2 using default parameters.

Ribo-seq analysis

The P-site position of each read was predicted by riboWaltz73 and confirmed by inspection. Counts were made by aggregating P-sites overlapping with the CDS and P-sites per kilobase million (PPKMs) were then generated through normalizing by CDS length and total counts for the sample. Differential expression and translational efficiency analysis was performed using DESeq272. All metagenes, stalling and ribosome dwelling occupancy (RDO) analyses are carried out on a subset of expressed canonical transcripts which had PPKM values greater than 1 across all samples (10,366 total). Within these, P-site depths per nucleotide were normalized to the mean value in their respective CDS. For metagenes around codon types, the mean of these normalized values is taken for each codon within 90 nucleotides of every instance of that codon. For RDO calculation for a given type of codon, the mean of these normalized values is taken over all instances of that codon, then these are compared using a log2-transformed fold change ratio between conditions. To assess relative pausing, P-site depths normalized to the CDS mean were compared at each codon position in the CDS. A value of 1 was added to these normalized depths and a log2-transformed fold change ratio was taken pairwise between conditions. To compare effects of different codon ending bases, the resulting values were separated by the ending base of each codon and plotted across their respective positions in the CDS. The relative pausing sum for each ending A, T, G or C is then the sum of these values for every codon containing the respective ending codon across the CDS. The fraction of nucleotides at ending codons were evaluated from extracting the codons for the CDS of each gene using GRCm38, release 101. Pathway level fractions were computed using the average of each gene contained in the pathway.

Ribo-seq in cell lines upon pharmacological DHPS or MYCN inhibition

To inhibit hypusination, cells were treated with 6.25 μM of the DHPS inhibitor GC7 (MedChemExpress) for 5 days. For MYCN inhibition, cells were treated with 5 μM MYCi975 (Selleckchem) for 4 days. Western blot analysis was performed to assess the efficacy of the inhibition. Following the respective treatment periods, cells were incubated with 100 μg ml−1 cycloheximide (Sigma) for 10 min at 37 °C. Cells were washed once with PBS containing 100 μg ml−1 cycloheximide, then trypsinized using a solution containing 100 μg ml−1 cycloheximide for 1 min at 37 °C. Cells were pelleted by centrifugation and washed with cold PBS containing 100 μg ml−1 cycloheximide. IMR5 cells were disrupted in a lysis buffer (20 mM Tris, pH 7.4, 140 mM KCl, 5 mM MgCl2, 1.0% Triton X-100, 1 mg ml−1 heparin, 25 U ml−1 Turbo DNase I (Roche, 04716728001), 1 mM DTT, 100 μg ml−1 cycloheximide (Sigma, C7698) and protease inhibitors (Roche, 04693132001). To obtain ribosome footprints 80 μl of lysates containing 150 g of total RNAs were treated with RNAse I (Ambion, AM2295) (250 U per mg of total RNA), for 60 min at 20°С with gentle agitation. Four microlitres SUPERaseIn RNase inhibitor (Ambion, AM2694) was added to stop nuclease digestion. Monosomes were isolated using S-400 columns (Cytiva, 27514001). Samples were then processed using Ribo-seq as described above.

Ribo-seq analysis of genetic inhibition of hypusination

Ribo-seq data from lymphoma cells with shRNAs targeting Renilla (sh-contl), Eif5a or Dhps were taken from Nakanishi et al.29. Raw data were downloaded from Gene Expression Omnibus (GEO) accession GSE190670 and were processed using Ribo-seq analysis as described above.

Ribo-seq analysis of genetic induction of MYC

Reprocessed and reanalysed data were from Elkon et al.74. Raw data were downloaded from GEO GSE66927 and were processed using Ribo-seq analysis as described above.

Ribo-seq analysis of genetic induction of MYCN amplified cell lines

Reprocessed and reanalysed data from Volegova et al.75. Raw data were downloaded from GEO accession GSE261760 and were processed using Ribo-seq analysis as described above.

In vitro experiments in neuroblastoma cell lines

Cell growth analysis

IMR5 cells were cultured in RPMI medium supplemented with 10% dialysed FBS (Gibco) and seeded into 384-well plates. Stock solutions of arginine, proline, DFMO and GC7 were dispensed into the 384-well plates using the Echo 650 (Beckmann Coulter) liquid handler in a concentration-dependent manner. The impact of varying proline and arginine concentration was assessed using RPMI free of arginine and proline and supplemented with 0%, 1%, 5%, 30%, 50% and 100% of standard RPMI levels of proline (174 μM) and arginine (1,149 μM). For polyamine supplementation, putrescine, spermidine or 1-methyl-spermidine (BenchChem), were supplemented in the respective concentrations as described above along with 1 mM aminoguanidine (Sigma-Aldrich). Additional rescue experiments were performed in different neuroblastoma cell backgrounds (SHEP, SKNBE2 and SHSY5Y). For quantification cells were then stained with 10 μM Hoechst 33342 (Invitrogen) and 1 μg ml−1 propidium iodide (Invitrogen) for 15 min at 37 °C/5% CO2. Fluorescent signals were captured and analysed at different time points using the Perkin-Elmer Operetta system to generate growth curve.

shRNA-mediated gene knockdown

Lentiviral particles were produced in HEK293 cells by co-transfection of lentiviral packaging plasmids pCMV-VSV-G and pPAX2 (Addgene) with pRSIT-U6Tet-shTarget-PGK-TetRep-2A-TagGFP2-2A-Puro (Cellecta) expressing the desired shRNAs using 25 kDa linear polyethylenimine (Polysciences). Viral supernatants were collected 48 h post-transfection. IMR5 cells were transduced with viral supernatants containing 4 μg ml−1 polybrene (Sigma) for 48 h. Cells were selected with 2 μg ml−1 puromycin (Gibco) 48 h post-transduction. 50 ng ml−1 doxycycline (Sigma) was used for at least 24 h to induce shRNA expression. The construct targets are reported in Supplementary Table 3.

Cell cycle analysis

Cells were seeded into 12-well plates at the density of 2 × 104 cells per ml and induced with 50 ng ml−1 doxycycline for 5 days. Cells were collected and incubated for 1 h in growth medium containing 10 μg ml−1 Hoechst 33342(Invitrogen). The stained cells were then analysed by flow cytometry and cell cycle distribution was quantified using the Modfit software.

Puromycin incorporation

IMR5 cells were treated with 500 μM DFMO in 20% ProArg RPMI medium supplemented with 10% dialysed FBS for 5 days. Cells in log growth phase (< 80% confluence) were labelled with 1 μM puromycin at 37 °C for 1 h, then the medium was replaced by Versene (Gibco) and 5 μM cycloheximide (Sigma) to inhibit protein translation. For western blot analysis lysates were separated electrophoretically and transferred to PVDF membranes (Bio-Rad), blocked with 5% non-fat milk in TBS-T, and detected with a mouse monoclonal puromycin antibody (Millipore, 1:10,000) at 4 °C overnight, followed by horseradish peroxidase-conjugated goat anti-mouse secondary (Proteintech, 1:10,000) for 1 h at room temperature. Protein bands were visualized using enhanced chemiluminescence (ECL) reagent (Bio-Rad) and imaged on a ChemiDoc system (Bio-Rad). For flow cytometry analysis, cells were fixed in 4% formalin at room temperature for 10 min and permeabilized with 0.1% Triton X-100 for 10 min. Cells were stained with PE anti-puromycin (BioLegend) for 30 min at 4 °C and analysed on a flow cytometer (Sony).

Western blotting of neuroblastoma cell line lysates

After cell lysis samples were transferred to PVDF membranes as described above. Antibodies used were used in the following concentrations: ODC1 (1:1,000, Abcam), MYCN (1:1,000, Santa Cruz), eIF5a (1:2,000, BD), eIF5A anti-hypusine (1:2,000, Merck Millipore), CENPR (1:1,000, Proteintech), KIF2C (1:1,000, Proteintech) and horseradish peroxidase-conjugated anti-GAPDH (1:10,000, Proteintech).

RT–qPCR

Total RNA from cells was isolated using Trizol (Invitrogen) according to the manufacturer’s instructions. One microgram of total RNA was used to generate cDNA adapted for quantitative PCR with reverse transcription (RT–qPCR) (TaKaRa Bio). Real-time PCR was carried out using a Quant Studio 7 Pro Real-Time PCR machine (Applied Biosystems) and GoTaq qPCR Master Mix (Promega). Fold change of gene expression was calculated by the 2−∆∆Ct formula using GAPDH as an endogenous reference. The list of primers for gene-expression analysis using RT–qPCR is reported in Supplementary Table 3.

In vitro translation

Template creation: DNA constructs NheI_IRES_HA_EcoRI_xxx_BamHI and nLuc_Myc_EcoRV were synthesized by Gene Script and cloned with NheI and EcoRV sites into pcDNA3.1+ vector. Triplet sequences were inserted between HA and nLuc using EcoRI and BamHI sites: 7× CCG-Pro and 7× CCA-Pro. DNA plasmids were linearized with NotI HF (NEB). In vitro T7 transcription with linear plasmids was performed with mMESSAGE mMACHINE Kit (Invitrogen, AM1344). For the cell lysate preparation IMR5 cells were seeded in 15 cm dish at a density of 1 × 106 per dish and cultured for 5 days. Cells were then collected and centrifuged at 1,000g for 5 min at 4 °C. Cell pellets (100 mg) were lysed in 1 volume (100 μl) of lysis buffer (LB, 30 mM HEPES/KOH (pH 7.6), 150 mM potassium acetate, 3.9 mM magnesium actetate, 4 mM DTT, 1% Triton X-100, 10% glycerol and protease inhibitor (Roche, 04693132001). Four microlitres SUPERaseIn RNase inhibitor (Ambion, was added. Cell debris was removed by centrifugation at 20,000g for 10 min at 4 °C. RNA and protein concentration were quantified in the cell lysate. Forty-microlitre aliquots of the cell lysates were snap frozen in liquid nitrogen and stored at −80 °C. Six microlitres were used for the in vitro translation reaction. In vitro translation was performed in a translational mix (15 mM HEPES/KOH (pH 7.6), 75 mM potassium acetate, 2 mM magnesium actetate, 1.75 mM ATP, 0.4 mM GTP, 50 μM complete amino acid mix (Promega, L4461), 20 mM creatine phosphate, 0.3 mg ml−1 creatine kinase, 500 ng RNA) for 3 h at 35 °C. Spermidine was added in a final concentration 1.5 mM, if indicated. Translation reaction product was detected with Nano-Glo Luciferase Assay System (Promega, N1110).

Immunoblots of Th-MYCN tumours

Collected Th-MYCN tumours were clamped and flash-frozen in liquid nitrogen. After this mechanical dissociation, crude protein extraction was obtained by lysis with CHAPS buffer (10 mM HEPES, 150 mM NaCl, 2% CHAPS) with fresh protease inhibitor and phosphatase inhibitor. This protein lysate (25 micrograms) was electrophoresed through a 5–10% Tris–glycine gel and immunoblotted using antibodies to MYCN (1:500, Cell Signaling), GAPDH (1:3,000, Cell Signaling Technologies) and eIF5A anti-hypusine (1:2,000, Millipore Sigma).

Isoelectric focusing blots

Crude protein extracts obtained as described above were electrophoresed through a slab isoelectric focusing gel (pH 3–7, Invitrogen Novex EC66452) with freshly made cathode and anode buffers (Novex). The gel was transferred to a PVDF membrane and transferred using the iBlot transfer unit prior to blocking in buffer according to manufacturer’s recommendations for iBind. The iBind was then assembled with a probe against eIF5A (1:3,000, BD Laboratories) and incubated for at least 2.5 h before developing.

Histology

Collected Th-MYCN tumours were preserved in 10% formalin and embedded in paraffin blocks. Slides were cut and then stained with H&E. These slides were reviewed by a pathologist blinded to the treatment groups, and tumours were scored according to: (1) differentiation status; (2) neuropil presence or absence and relative abundance; and (3) evidence of global or localized necrosis. Slides were then scanned and re-reviewed by the same pathologist.

Immunohistochemistry in Th-MYCN tumours

Slides of formalin fixed, paraffin embedded tumours were stained on a Bond Max (MYCN, Ki67) automated staining system (Leica Microsystems). The Bond Refine staining kit was used for MYCN and Ki67. For MYCN (1:100, Abcam) and Ki67 (1:200, Abcam), the standard protocol was followed with the exception of the primary antibody incubation which was extended to 1 h at room temperature. Antigen retrieval was performed with E2 (Leica Microsystems) retrieval solution for 20 min. After staining, all slides were rinsed, dehydrated through a series of ascending concentrations of ethanol and xylene, then cover-slipped. Stained slides were then digitally scanned at 20× magnification on an Aperio CS-O or AT2 slide scanner (Leica Biosystems) and reviewed by a pathologist blinded to the treatment groups.

LC–MS/MS analysis of tRNA ribonucleosides

Tumours were collected and pulverized as described above. From the resulting tissue powder total RNA was extracted using TRIzol according to the manufacturer’s instructions (Invitrogen) followed by tRNA isolation by gel extraction from denaturing 8 M urea, 8% polyacrylamide gels. Gel-extracted tRNA (560 ng) was enzymatically digested with 0.8 U nuclease P1 from Penicillium citrinum (Sigma, N8630) and 80 U GENIUS nuclease (Santa Cruz Biotech, sc-391121b) in 10 mM ammonium acetate (pH 6.0), 1.0 mM magnesium chloride at 40 °C for 70 min. Hydrolysed ribonucleotides were dephosphorylated at 37 °C for 70 min by 0.4 U snake venom phosphodiesterase (Sigma, P3243) and 0.16 U alkaline phosphatase from Escherichia coli (Sigma, P5931) after adjusting the pH with ammonium bicarbonate to a final concentration of 50 mM. The hydrolysates were mixed with 3 volumes of acetonitrile and centrifuged (16,000g, 40 min, 4 °C). The supernatants were lyophilized and dissolved in H2O for LC–MS/MS analysis. Four biological replicates for each condition (CD, CD plus DFMO, ProArg-free, ProArg-free plus DFMO) were measured, each in two technical replicates. Nucleosides were separated via reversed-phase chromatography using a Vanqush Neo UHPLC system (Thermo Fisher Scientific) and an Acquity nanoEase M/Z Peptide BEH C18 Column (130 Å, 1.7 μm, 300 μm × 150 mm; Waters, 186009259) and analysed on an Orbitrap Exploris 480 mass spectrometer (Thermo Fisher Scientific) operating in a positive-ion mode at a resolution of 45,000, the AGC target value set to 1.0 × 106 and the fill time to 50 ms. Full MS spectra (m/z 244–576) and Top7 ddMS2 spectra with a nominal collision energy of 85% were recorded. Quantitative analysis of LC–MS/MS data was performed using ElMaven software (https://github.com/ElucidataInc/ElMaven) and the identities of quantified ribonucleosides were verified by their specific fragmentation patterns in MS2 and by predetermined chromatographic elution orders of structural isomers76,77. Normalization was performed to the mean intensity of 32 nucleosides that were detected in all measurements. For nucleosides that showed a marked difference in intensity between the two technical replicates due to degradation, the second technical replicate was excluded.

Proteomics

Total proteome sample preparation

Tissues were disrupted by grinding in frozen state and lysed in lysis buffer (20 mM HEPES pH 7.2, 2% SDS). Proteins extracts were diluted 1:1 with 2× SDS buffer (10% SDS, 100 mM Tris pH 8.5), boiled for 10 min at 95 °C, reduced with 5 mM (final) TCEP for 15 min at 55 °C, and alkylated with 20 mM (final) CAA for 30 min at room temperature. Proteins were acidified by addition of 3% (final) perchloric acid, followed by addition of seven volumes of binding buffer (90% methanol, 100 mM TEAB). Samples were loaded on S-trap columns and processed on a Resolvex A-200 positive pressure unit (Tecan). Samples were washed 1× with binding buffer, 3× with 50% methanol/50% CHCl3 and 2× with binding buffer. Digestion buffer (150 μl TEAB 50 mM) containing trypsin 1:10 (wt:wt, enzyme:protein) and Lys-C mix 1:50 (wt:wt, enzyme:protein) was added and incubated for 1 h at 37 °C. One-hundred microlitres of digest buffer was added, and incubated overnight. Peptides were eluted with 80 μl 0.2% aqueous formic acid followed by 80 μl of 50% acetonitrile containing 0.2% formic acid. Peptides were diluted 1:1 with STOP buffer (PreOmics) and purified over iST positive pressure plates (PreOmics) according to the manufacturer’s instructions.

Nanoflow LC–MS/MS measurements for proteomes

Peptides were separated on an Aurora (Gen3) 25 cm, 75 μm internal diameter column packed with C18 beads (1.7 μm) (IonOpticks) using a Vanquish Neo (Thermo Fisher Scientific) UHPLC. Peptide separation was performed using a 90-min gradient of 2–17% solvent B (0.1% formic acid in acetonitrile) for 56 min, 17–25% solvent B for 21 min, 25–35% solvent B for 13 min, using a constant flow rate of 400 nl min−1. Column temperature was controlled at 50 °C. Mass spectrometry data were acquired with a timsTOF HT (Bruker Daltonics) in diaPASEF mode. Mass spectrometry data were collected over a 100–1,700 m/z range. During each MS/MS data collection each PASEF cycle was 1.8 s. Ion mobility was calibrated using 3 Agilent ESI-L Tuning Mix ions: 622.0289, 922.0097 and 1221.9906. For diaPASEF we used the long-gradient method which included 16 diaPASEF scans with two 25 Da windows per ramp, mass range 400.0–1,201.0 Da and mobility range 1.43–0.6 1/K0. The collision energy was decreased linearly from 59 eV at 1/K0 = 1.6 to 20 eV at 1/K0 = 0.6 V cm−2. Both accumulation time and PASEF ramp time was set to 100 ms.

Mass spectrometry data quantification

Raw mass spectrometry data were analysed with Spectronaut (v.17.1) in directDIA mode with standard settings. Database search included the mouse Uniprot FASTA database.

Proteomics analyses

Protein intensity values were normalized by log2 transformation and proteins with less than 70% of valid values in at least one group were filtered out. The remaining missing values were imputed using the mixed imputation approach78. In brief, missing values in samples belonging to the same group were imputed with k-nearest neighbours if there is at least 60% of valid values in that group, for that protein. The remaining missing values are imputed with the MinProb method (random draws from a Gaussian distribution; width = 0.2 and downshift = 1.8).

Circulating turnover flux

To measure the circulating turnover flux of a metabolite, we infused [U-13C]labelled form of the respective metabolite via the jugular venous catheter. At pseudo-steady state, the fraction of the labelled of mass isotopomer form [M + i] of the nutrient in serum is measured as \(L_[M+i]\), such that i is from 0 to C and C is the total number of carbons in the metabolite. The circulatory turnover flux Fcirc is defined as previously79:

$$F_\rmcirc=R\times \frac1-L_[M+C]L_[M+C]$$

(1)

where R is the infusion rate of the labelled tracer. Since the turnover flux is a pseudo-steady state measurement, for minimally perturbative tracer infusions, production flux is approximately equal to consumption flux of the metabolite and thus Fcirc reflects both the circulating production and consumption fluxes of the infused metabolite in units of nmolC min−1 g−1.

The carbon atom circulatory turnover flux \(F_\rmcirc^\rmatom\) of the nutrient is calculated using

$$F_\rmcirc^\rmatom=C\times R\times \frac1-LL$$

(2)

where L is the fraction of labelled carbon atoms in the nutrient:

$$L=\frac\sum _i=0^Ci\times L_[M+i]C$$

(3)

\(F_\rmcirc\) measures the turnover of the whole carbon skeleton of the molecule, whereas \(F_\rmcirc^\rmatom\) measures the turnover of the carbon atoms in the molecule.

Normalized metabolite labelling

When a [U-13C]-labelled tracer X is infused, the normalized labelling of downstream metabolite Y is defined as \(L_Y\leftarrow X=\fracL_YL_X\), where LX and LY are the fraction of labelled carbon atoms for metabolite X and Y defined in equation (3).

Fractional contribution to tissue metabolites

Direct fractional contribution of each metabolite to other metabolites in a tissue is calculated by setting up the follow set of linear equations:

$$M\cdot \left(\beginarrayc\beginarraycf_k\leftarrow \rmproline\\ f_k\leftarrow \rmarginine\\ \vdots \endarray\\ f_k\leftarrow \rmglutamine\endarray\right)=\left(\beginarrayc\beginarraycL_k\leftarrow \rmproline\\ L_k\leftarrow \rmarginine\\ \vdots \endarray\\ L_k\leftarrow \rmglutamine\endarray\right)$$

(4)

Where \(f_k\leftarrow i\) is the fraction of k derived directly from i, M is the circulating metabolite interconversion matrix and is taken such that entry (X,Y) represents \(L_Y\leftarrow X\). Direct contributions to tissue were then calculated by performing an optimization procedure conditional on non-negative values by finding min ||M, f – L|| with respect to f such that f > 0. Standard error was estimated using a bootstrapping method (n = 100 simulations) by selecting values for M and L from normal distributions with means and standard deviations equal to calculated values for those parameters based on measured data.

Circulating metabolites flux

The procedure for calculating fluxes between circulating nutrients has been previously described thoroughly79. The input data for this calculation are the inter-labelling matrix M that reflects the extent to which infusion of any nutrient i (of n total nutrients of interest) labels every other circulating nutrient j and the carbon atom circulatory turnover flux for each circulating nutrient \(F_\rmcirc^\rmatom\). The procedure first uses M to calculate the direct contributions to each nutrient i from all other circulating nutrients j, creating a new n × n matrix N whose entries Nij reflect the direct contributions of circulating nutrient j to circulating nutrient i. It then utilizes the matrix N and \(F_\rmcirc^\rmatom\) to calculate the direct contributing fluxes from any circulating nutrient to any other circulating nutrient, resulting in a complete determination of the inter-converting fluxes in units of nmolC min−1 g−1 between circulating nutrients. Fluxes were computed using Matlab (v.R2019a). The network was visualized using Cytoscape (v2.9.0).

Multi-omics GSEA

All omics were analysed and visualized in R (Statistical Computing, v.4.1.0). Gene set enrichment was performed using fgsea (https://bioconductor.org/packages/release/bioc/html/fgsea.html) using as input gene or protein list rank by relative changes (log2-transformed fold change of comparison). Gene sets were taken from the Mouse MSigDB Collections using the gene sets MH (Hallmark) and the M2 (canonical pathways) using the Reactome subset80. We used 1,000 permutations of the gene-level values to calculate NES and statistical significance.

Neuroblastoma MYCN-driven regulatory circuits transcript and protein levels

The super enhancer core regulatory circuitry has been described by Durbin et al.40 and modified by Decaesteker et al.54. The retino-sympathetic and adrenergic circuit has been described by Zimmerman et al.81.

Deconvolution of cell types from bulk RNA-seq

To determine cell-type abundance a deconvolution approach was used leveraging the bulk gene-expression profiles of the Th-MYCN tumours for the four treatment groups: CD, ProArg-free diet, CD plus DFMO and ProArg-free diet plus DFMO. We used the CIBERSORTx82, a machine learning method to infer cell-type proportions without physical cell isolation based on the creation of a signature matrix of cell types identified in Th-MYCN tumour model in published single-cell RNA-sequencing data by Costa et al.83. Using this high-resolution single-cell annotation of the tumour microenvironment in Th-MYCN mice the digital cytometry tool was run on bulk tumour expression to extract cell-type abundances and dissect the effect of treatment on the tumour microenvironment.

Statistics and reproducibility

The number of human and mouse samples is recorded in the figure captions. For human tumour measurements, n represents the number of patients. For mouse experiments, n represents the number of mice. P values were computed using an unpaired two-sided Welch’s t-test using the Welch–Satterthwaite equation (not assuming equal variances) unless specified otherwise. Regression between adenosine-ending codon and protein levels were calculated with the R function stat_cor (package ggpubr) to compute Pearson’s r and geom_smooth (package ggplot2) using ‘linear model’ to display the regression line. Statistics were performed using R (v.4.1.0).

Metabolomics

A two-tailed unpaired Welch’s t-test was used to calculate P values. Metabolomics data were corrected for multiple comparisons using the Benjamini–Hochberg method, with a FDR cut-off of 0.05 used to determine statistical significance.

Transcriptomics

P values were corrected for multiple hypothesis testing using the Benjamini–Hochberg method, with a FDR cut-off of 0.05 used to determine statistical significance.

Proteomics

Two-sided Student’s t-tests were calculated with a permutation-based FDR cut-off of 0.05 and s0 = 1 if not otherwise declared.

tRNA mass spectrometry

A two-tailed unpaired Welch’s t-test was used to calculate P values. Modifications were corrected for multiple comparisons using the Benjamini–Hochberg method, with an FDR cut-off of 0.05 used to determine statistical significance.

Mouse survival analyses

Comparisons of outcome between groups were performed by a two-sided log-rank test, tumour-related death is counted as an event, with mice censored at the time of death without tumour or necropsy. Survival was statistically assessed according to the method of Kaplan and Meier84 according to Peto and Peto85.

Reproducibility

Representative results, such as blots and H&E staining, were independently validated in at least two independent experiments yielding similar results. This include Fig. 6g,h, Extended Data Figs. 8d,e,n and 9i and Supplementary Figs. 2b, 3b, 4f and 7b.

Ethics statement

Animal studies followed protocols approved by the Princeton University and Children’s Hospital of Philadelphia Institutional Animal Care and Use Committees. Patient samples obtained from the COG (Neuroblastoma Biology Committee) underwent review and approval through a Cancer Therapy Evaluation Program overseen process: application ANBL16B2 Q, principal investigator J.D.R.

Reporting summary

Further information on research design is available in the Nature Portfolio Reporting Summary linked to this article.

RELATED ARTICLES

Most Popular

Recent Comments