Friday, July 17, 2026
No menu items!
HomeNatureDivergent evolutionary strategies pre-empt tissue collision in gastrulation

Divergent evolutionary strategies pre-empt tissue collision in gastrulation

Experimental animals and embryo collection

D. melanogaster embryos were collected on apple juice agar plates with yeast paste at 22 °C or at the temperatures indicated below. Laboratory cultures of M. abdita (Sander strain) were maintained as described52. M. abdita embryos were collected on apple juice agar plates with fish food paste at 25 °C. The laboratory cultures of C. riparius (Bergstrom strain) were maintained as described52. C. riparius embryos were collected as freshly deposited egg packages at ambient room temperature (23–26 °C). The laboratory cultures of C. albipunctata were maintained as described53,54. Embryos were obtained after dissecting-out adult female ovarioles, followed by experimental egg activation through a hypo-osmotic shock. The laboratory cultures of H. illucens were established from existing cultures in the Schmidt-Ott lab (University of Chicago). To collect H. illucens embryos, females were decapitated to trigger egg laying at the desired time.

A transient laboratory culture of C. fuscipes was established from wild-caught adults found near the municipal compost plant of the city of Heidelberg. C. fuscipes adults prefer to lay eggs in small cavities. To collect embryos, old culture plates of C. albipunctata were used as they conveniently have such cavities. Before using these for C. fuscipes egg collection, the plates were decontaminated by freezing them at −20 °C for at least 1 week, followed by thawing overnight at room temperature.

We could not establish a laboratory culture for any of the species from the family Empididae, because we could not optimise the culture conditions. During our excursion in Pula (Croatia) we managed to catch a few adults of an Empis species (most probably Empis pennipes, referred to as Empis sp. throughout the text). As a result, we resorted to repeatedly catching adults during that time from the wild, and then decapitated the females to trigger egg laying.

Drosophila genetics and transgenic lines

D. melanogaster lines used for live imaging were MyoII–eGFP (also known as Spaghetti-squash–eGFP, or Sqh–eGFP)55, Gap43-mCherry56, MyoII-mKate2 (ref. 57) and mat-tub-3xmScarlet-CaaX (this study). The membrane imaging line mat-tub-3xmScarlet-CaaX was made by cloning 3xmScarlet-CaaX into the pBabr vector containing the mat-tub promoter (gift from D. St. Johnston, Gurdon Institute, UK)58 and the sqh 3′ untranslated region (UTR), followed by ΨC31 site-directed integration into the attP2 or attP40 landing sites at WellGenetics. D. melanogaster mutant alleles used were eveR13 (FlyBase ID: FBal0003885), btdAX (FlyBase ID: FBal0030657), stg7M53 (FlyBase ID: FBal0016176) and the quadruple mutant33 knirpsIID48 (FlyBase ID: FBal0005780) hunchback7M48 (FlyBase ID: FBal0005395) forkheadE200 (FlyBase ID: FBal0004007) taillessL10 (FlyBase ID:FBal0016889). Descriptions of phenotypes associated with eveR13 (http://flybase.org/reports/FBal0003885.htm) and btdAX (http://flybase.org/reports/FBal0030657.htm) were obtained from FlyBase (release FB2025_03)59. In live imaging experiments, the mutant embryos were identified on the basis of the absence of a balancer-linked reporter construct, hb0.7-Venus-NLS, inserted on the FM7h, CyO or TM3 balancer12.

To generate the eve1KO line, an eve genomic rescue construct, eveCH322-103K22-mNeonGreen, was first created using P[acman]CH322-103K22 (BACPAC Resources Center), a BAC construct that encompasses the entire eve locus, from which the stop codon of eve was replaced with a standard protocol60,61 with mNeonGreen following a linker (N-ter-GSAGSAAGSGEV-C-ter). To completely eliminate eve expression in the Eve1 region, the stripe1 (+6.6 to +7.4 kb relative to the transcriptional start site of eve)25 and late element (−6.4 to −4.8 kb)24 enhancers were deleted from eveCH322-103K22-mNeonGreen through homologous recombination using the following homology arm sequences: stripe1 left, GCAAGTCCGAGACAAATCCACAAATATTGTCAACTCTTTGGCTCTAATCTG; right, CCAAGGCCGCAAAGTCAACAAGTCGGCAGCAAATTTCCCTTTGTCCGGCGA; and late element left, TTGCGTTTGAGCTACGTTACTTACATTTTTCCCACATGAGTCGGGCATACA; right, TCGATGGGTTGGTCACAATGTGGTGGCCTCTCAACATTGCAAGGCTCTTAC. The resultant BAC construct, eveCH322-103K22-mNeonGreenΔst1ΔLE (Extended Data Fig. 4a) was integrated into PBac{y[+]-attP-3B}VK00033 at Rainbow Transgenics, and crossed into the eveR13 mutant line to generate the eve1KO line. Identification of eve1KO embryos in live imaging experiments was performed as above, on the basis of the absence of a balancer-linked reporter construct, hb0.7-Venus-NLS, inserted on the CyO12.

For Insc overexpression, males of UAS-insc were crossed to females containing two copies of nos-GAL4-GCN4-bcd3’UTR, which directs targeted gene expression in the head region of resultant embryos62. These female flies also contained transgenes for the imaging markers Sqh–eGFP and 3xmScarlet-CaaX. The flies were incubated at 22 °C for embryo collection. For Opto-DNRho1 experiments, females of UASp-CIBN-CaaX; UASp-CRY2-Rho1[N19, Y189]27 (a gift from B. He, Dartmouth College, USA) were crossed to males of matαTub-Gal4VP1667C; matαTub-Gal4VP1615 double driver line that also contains the transgene for mat-tub-3xmScarlet-CaaX imaging marker. The resultant F1 flies were used to set up egg deposition cages that were kept at 18 °C for collection of embryos used in the experiments.

Protein tree

Predicted protein sequences of eve and btd were used as queries to identify closely related genes in D. melanogaster and putative orthologues in M. abdita and C. riparius using BLAST. Protein alignments were performed in Geneious by MUSCLE alignment with standard parameters. The protein tree was assembled using Jukes–Cantor as the genetic distance model and UPGMA (unweighted pair group method with arithmetic mean) for tree building, with a bootstrap of 1,000 replicates.

Cloning, and messenger RNA and double-stranded RNA synthesis

Cri-btd, Cri-eve, Cri-insc, Cri-sqh, Mab-btd and Mab-eve were identified from published transcriptome sequences and cloned after polymerase chain reaction amplification from complementary DNA. In vivo labelling of cell outlines and MyoII in C. riparius used Gap43-linker–eGFP and Cri-Sqh-linker–eGFP, which were expressed in the embryo by the injection of in vitro synthesized messenger RNAs. The Gap43-linker–eGFP fusion construct for mRNA synthesis was generated by in-frame Gibson assembly of the Gap43 encoding sequence, a short linker (GSAGSAAGSGEV), and a previously published pSP35T expression vector (pSP-Mab-bsg–eGFP) that contained a 3′-terminal eGFP63. Analogously, the Cri-Sqh-linker–eGFP fusion construct was generated using a full-length fragment of Cri-sqh amplified by polymerase chain reaction from cDNA. Nascent mRNAs were generated using SP6 polymerase, followed by capping and poly(A)-tailing with dedicated capping and poly(A) kits (CELLSCRIPT). Synthesized mRNA was dissolved in H2O.

For btd RNAi experiments in D. melanogaster, double-stranded RNA was synthesized on templates that contain the T7 promoter sequence (5′-TAATACGACTCACTATAGGGTACT-3′) at each end using a MEGAscript T7 kit (Ambion); templates were amplified from 0–4 h embryonic cDNA using specific primers (5′-AGCAGATGACGACGACAACA-3; 5′-TACTCGGACTTCATGTGGCA-3). For insc RNAi experiments in C. riparius, dsRNA was synthesized as previously described63. The dsRNAs comprised the following gene fragments (position 1 refers to first nucleotide in the open reading frame): btd, position 1,487 to 1,817; Cri-insc (GenBank PV919477), position 466 to 1,892.

Injections

For dsRNA injections in D. melanogaster, 0–1 h-old (up to stage 2) embryos were collected, dechorionated with bleach and mounted on an agar pad. The mounted embryos were then picked up using a coverslip painted with glue (prepared by immersing bits of Scotch tape in heptane), desiccated for 10–14 min using Drierite (W. A. Hammond Drierite Co.) and covered with a mixture of Halocarbon oil 700 and 27 (Sigma-Aldrich) at a ratio of 3:1. Needles for injection were prepared from micro-capillaries (Drummond Microcaps, outer diameter 0.97 mm, inner diameter 0.7 mm) pulled with a Sutter P-97/IVF and bevelled with a Narishige pipette beveller (EG-44). Injections were performed on a Zeiss Axio Observer D1 inverted microscope using a Narishige manipulator (MO-202U) and microinjector (IM300). A volume of ~144 pl of solution with a concentration of 1.1–1.6 μg μl−1 or 8–12 μg μl−1 dsRNA was injected into the embryo. Embryos were kept at 25 °C after injection in a moist chamber until early to mid-cellularization, followed by live imaging.

For injections in C. riparius, embryos were collected, prepared and injected essentially as described previously52. Embryos were injected before the start of cellularization (~4 h after egg deposition), and then kept in a moist chamber until the onset of gastrulation. Throughout all procedures, embryos were kept at 25 °C (±1 °C). Owing to their small size, C. riparius embryos (200 µm length) were always injected into the centre of the yolk (50% of anterior–posterior axis). Embryos were injected with dsRNA typically at concentrations of 300 to 700 ng ml−1; mRNA was injected typically at concentrations of 1.5–2.5 μg μl−1 (Cri-Gap43–eGFP and Cri-Sqh–eGFP). LifeAct-mCherry was injected as a recombinant protein as previously described at ~4.5 mg ml−1 (ref. 63).

Live imaging

Live imaging of D. melanogaster embryos was performed using two-photon scanning microscopy with a 25× water immersion objective (numerical aperture = 1.05) on an upright Olympus FVMPE-4GDRS system (InSight DeepSee pulsed IR Dual-Line laser, Spectra Physics) or an inverted Olympus FVRS-F2SJ system (Maitai and InSight DeepSee lasers), or a Plan-Apochromat 25× oil immersion objective (numerical aperture = 0.8) on a Zeiss LSM980 inverted microscope (Chameleon laser, Coherent Int). Excitation wavelengths were 920 nm for eGFP, 950 nm for Venus and 1,040 nm (upright) or 1,100 nm (inverted) for mKate2, mCherry or mScarlet. Three imaging settings were used with the following parameters (total z depth, xy dimension of the imaging region of interest (ROI), z-step size, time interval, imaging angle or view): (1) ~80 µm, 539.5 × 185.5 µm, 2 µm, 90 s, whole-embryo lateral or ventral views; (2) ~60 µm, 253.5 × 152 µm, 1.5 µm, 50 s, head domain; (3) ~40 µm, 208.3 × 152 µm, 1 µm, 45 s, cell division in head MDs. Embryos were collected, dechorionated and mounted on coverslips or glass-bottom dishes, and immersed in 1× phosphate-buffered saline for imaging.

Live imaging of C. riparius embryos was performed on a Leica SP8 confocal using a 63× glycerol immersion objective (numerical aperture = 1.30). z-stacks of ~25 µm depth were acquired at a z-step size of 1 µm and 90 s time interval. All recordings were performed at 25 °C.

Time-lapse imaging to visualize GBE was performed on Nikon Eclipse-Ti microscope in differential interference contrast mode, using a 20× objective (numerical aperture = 0.8) for D. melanogaster, M. abdita, C. riparius and C. albipunctata, with 1 frame every 1 min; on a Leica SP5 DMI6000CS inverted confocal microscope in transmission illumination mode, using a 40× objective (numerical aperture = 1.1) for C. fuscipes, with 1 frame every 2 min; and on Zeiss Colibri upright microscope in differential interference contrast mode, using a 10× objective (numerical aperture = 0.45) for H. illucens and a 20× objective (numerical aperture = 0.5) for Empis sp., with 1 frame every 3 min. All recordings were performed at 25 °C.

Optogenetics

The Opto-DNRho1 system27 was used as previously reported. To prevent unwanted photo-activation, Fly crosses and cages were kept in the dark and embryos were processed, staged and mounted in a dark room with a light source covered by a light red filter (no. 182, Lee Filters). Imaging was performed on an Olympus FVMPE-RS (InSight DeepSee pulsed IR Dual-Line laser system, Spectra Physics) with a 25× (numerical aperture = 1.05) water immersion objective and excitation wavelength of 1,040 nm for the membrane marker 3xmScarlet-CaaX. The efficacy of MyoII inhibition with the Opto-DNRho1 system was first benchmarked on ventral furrow formation to confirm that it resulted in a complete blockage of apical constriction27.

Two photo-activation protocols were used: protocol no. 1 used a 405 nm diode laser at 0.1% power (5.48 µW) and protocol no. 2 used a 458 nm diode laser at 0.5% power (27.14 µW), both scanned at 2 µs per pixel. Sham controls were performed at 0% laser power. The photo-activation ROI was illuminated for 3 s in all experiments.

Three experimental designs were used: (1) lateral imaging with unilateral photo-activation (Fig. 2h,i, Extended Data Fig. 5a and Supplementary Video 4) used protocol no. 1 on a 28.15 × 197.05 µm ROI (50 × 350 pixels) centred on ‘the pre-CF domain’64 covering the entire region of CF initiation along the dorso-ventral circumference, beginning 16–33 min before gastrulation and repeated every 90 s; (2) ventral imaging with bilateral photo-activation (Fig. 4a,b and Supplementary Video 7) used protocol no. 1 on two 33.78 × 33.78 µm ROIs (60 × 60 pixels) each covering one side of the CF, beginning 18–30 min before gastrulation and repeated every 180 s; and (3) ventral imaging with bilateral photo-activation and long-term imaging (Fig. 4d,e and Supplementary Video 8) used protocol no. 2 on two 28.8 × 28.8 µm ROIs (40 × 40 pixels) each covering one side of the CF, beginning 15–30 min before gastrulation and repeated every 180 s for 1 h, followed by time-lapse imaging at 10 or 20 min per frame for 18–23 h.

Immunofluorescence and fixed imaging

For antibody staining, embryos were fixed by a heat–methanol method65 and immunostained with mouse monoclonal anti-Neurotactin (1:20, BP106, Developmental Studies Hybridoma Bank, USA), rabbit polyclonal anti-Eve (1:500, gift from M. Biggin, Lawrence Berkeley National Laboratory, USA), and rat polyclonal anti-Btd (1: 500, gift from E. Wieschaus, Princeton University, USA), followed by DAPI staining to visualize nuclei. Imaging was performed on a Leica SP8 system using a 20× (numerical aperture = 0.75) multi-immersion objective with oil immersion (total z depth: 60–90 µm, z-step size: 1.04 µm).

For DNA staining, embryos were fixed by heat and devitellinized as described66, followed by staining with DRAQ5 (1:1,000 for 1 h, Thermo Fisher Scientific, catalogue number 62251). Imaging was performed on a Leica SP8 system with a 20× glycerol objective (numerical aperture = 0.75) for D. melanogaster, M. abdita, H. illucens and C. albipunctata, and a 63× glycerol objective (numerical aperture = 1.3) for C. fuscipes and C. riparius, with a z-step size of 1 µm in a z-range that covers at least half of the embryo.

For the hybridization chain reaction (HCR), embryos were fixed by heat and devitellinized as described54, probes for Cri-btd and Cri-eve were generated using previously published software67 (https://github.com/rwnull/insitu_probe_generator) and ordered through Sigma-Aldrich. HCR amplifiers (B1-Alexa488 for Cri-eve; B2-Alexa594 for Cri-btd) were obtained from Molecular Instruments. Devitellinized embryos were re-hydrated in a series of 1× phosphate-buffered saline with Tween (PBT) and post-fixed for 40 min with 4% paraformaldehyde in PBT on a shaker. Following PBT washes, we followed the In situ HCR v.3.0 protocol68 for whole-mount fruit fly embryos Revision 9 (13 February 2023) from Molecular Instruments. We then stained the embryos with DRAQ5 in 5× saline-sodium citrate with Tween (1:1,000 for 1 h) and mounted the embryos in 50% glycerol in 5× saline-sodium citrate with Tween. Imaging was performed as above for DNA staining in Chironomus riparius.

For in situ hybridization, embryos were fixed by a heat–formaldehyde method63. Transcripts were detected histochemically or fluorescently as described69, using RNA probes for Mab-btd (comprising 1,473 nucleotides from +1 to 1,473, with position +1 referring to first nucleotide in the open reading frame), Mab-eve (comprising 984 nucleotides, from position 365 to 996 of the putative coding sequence and 351 nucleotides of the 3′ UTR), and Cri-insc (comprising 1,427 nucleotides from 466 to 1,892) labelled with either digoxigenin or fluorescein. M. abdita embryos were also stained with DAPI to visualize nuclei.

Image processing and quantification

Images were processed, assembled into figures and converted into videos using FIJI, Affinity Designer, Adobe Illustrator and HandBrake. Quantitative data were analysed and processed using Excel, or custom-made ImageJ or FIJI macros and Python scripts using Numpy, Pandas and SciPy libraries. Plots were generated in GraphPad Prism or with Python scripts using Matplotlib and Seaborn graphic libraries. Detailed descriptions of image processing and analysis procedures are provided in Supplementary Methods.

Statistical analyses

All of the statistical details of experiments, including the number of experiments (n), which represents the number of embryos used unless otherwise noted, are given in the figure legends. Python scripts using SciPy library were implemented to perform one-way ANOVA followed by Tukey’s multiple comparison post hoc test for comparing means from more than two groups, and Mann–Whitney U-test was used as a non-parametric independent test for comparing two means. GraphPad Prism was used: (1) to perform statistical analyses to compare the blastoderm cell densities across species, including the calculation of medians and the 95% confidence intervals on the median, and one-way ANOVA with Kruskal–Wallis non-parametric test, without correcting for multiple comparisons (uncorrected Dunn’s test); and (2) to perform Fisher’s exact test with Bonferroni correction for pie chart distributions. For cell and domain area analysis, Microsoft Excel was used to perform paired and unpaired t-tests and to plot standard errors.

Reporting summary

Further information on research design is available in the Nature Portfolio Reporting Summary linked to this article.

RELATED ARTICLES

Most Popular

Recent Comments