Tuesday, July 14, 2026
No menu items!
HomeNatureMechanism of BRCA1–BARD1 function in DNA end resection and DNA protection

Mechanism of BRCA1–BARD1 function in DNA end resection and DNA protection

Cloning, expression and purification of recombinant proteins

Human wild-type DNA2, helicase-dead DNA2 K654R and nuclease-dead DNA2 D277A were expressed in Sf9 insect cells and purified by affinity chromatography taking advantage of the N-terminal 6×His tag and the C-terminal FLAG tag35. Yeast nuclease-dead Dna2 E675A was expressed in S. cerevisiae and purified using the N-terminal FLAG tag and the C-terminal 6×His tag51. Full-length wild-type WRN, helicase-dead WRN K577M, exonuclease-dead WRN E84A, WRN fragments, BLM, as well as wild-type CtIP and its variants were purified exploiting the MBP tag at the N terminus and 10×His tag at the C terminus23,28,35,38,52,53. The MBP tag was removed during purification by cleavage with PreScission protease. For the expression of phosphorylated wild-type CtIP (pCtIP) and its variants, Sf9 cells were treated with 50 nM Okadaic acid (APExBIO) 3 h before collection to preserve the phosphorylated state of the proteins, and 1 µM camptothecin (Sigma) 1 h before collection to increase the activation of the protein phosphorylation cascade. For the expression of dephosphorylated WRN (λWRN) and CtIP (λCtIP), proteins were incubated with λ phosphatase at room temperature for 30 min during purification. The MRN and MRE11–RAD50 complexes were obtained using the 6×His tag and 3×FLAG tag at the C termini of MRE11 and RAD50, respectively23. Human wild-type EXO1, as well as nuclease-dead EXO1 D173A, were purified using M2 anti-FLAG affinity resin (Sigma) and HiTrap SP HP cation exchange chromatography column (Cytiva)26,54. EXO1Δ1 (Δ353–846) fragment, along with a matched wild-type control, were purified omitting the HiTrap SP HP cation exchange chromatography step. E. coli ExoIII, ScaI and SspI were purchased from New England Biolabs. Wild-type human RAD51, as well as the indicated human RAD51 variants and yeast Rad51, were expressed in BL21 (DE3)pLysS E. coli cells and purified using amylose affinity chromatography followed by HiTrap Q chromatography (Cytiva)48.

The BRCA1 sequence was codon optimized for the expression in Sf9 cells (Biomatik) with flanked NheI and XmaI restriction sites. The full-length sequence is listed in Supplementary Table 1 provided in the Supplementary Information. The BRCA1 gene was then cloned into pFB-2×MBP-CtIP-10×His55 to generate pFB-2×MBP-BRCA1co-10×His. The cloning created a fusion construct with the 2×MBP tag at the N terminus and the 10×His tag at the C terminus. All BRCA1 variants were cloned from pFB-2×MBP-BRCA1co-10×His using the primers listed in Supplementary Table 3 provided in the Supplementary Information. Similarly, the BARD1 sequence was codon optimized for the expression in Sf9 cells (Supplementary Table 2 provided in the Supplementary Information, Biomatik) with BamHI and XmaI restriction sites. The BARD1 gene was then cloned into pFB-RAD50co-FLAG23 to generate pFB-BARD1co-FLAG (BARD1 with C-terminal FLAG tag). All BARD1 variants were cloned from pFB-BARD1co-FLAG using the primers listed in Supplementary Table 3 provided in the Supplementary Information. The BRCA1–BARD1 complex, BRCA1 on its own and all variants were expressed in Sf9 cells using the SFX Insect serum-free medium (Hyclone) and the Bac-to-Bac expression system (Invitrogen), according to the manufacturer’s recommendations. Frozen Sf9 pellets from 1 l of culture were resuspended in lysis buffer (50 mM Tris-HCl pH 7.5, 1 mM ethylenediaminetetraacetic (EDTA), 1:400 protease inhibitor cocktail (Sigma, P8340), 30 µg ml−1 leupeptin (Merck Millipore), 1 mM phenylmethylsulfonyl fluoride (PMSF), 1 mM dithiothreitol (DTT), 0.5% NP40) and incubated at 4 °C for 20 min. Glycerol was added to a final concentration of 25%, NaCl was added to a final concentration of 325 mM and the cell suspension was incubated at 4 °C for 20 min. The cell suspension was centrifuged at 55,000g at 4 °C for 30 min. The soluble extract was incubated with amylose resin (New England Biolabs) at 4 °C for 1 h. The resin was washed with amylose wash buffer (50 mM Tris-HCl pH 7.5, 2 mM β-mercaptoethanol, 300 mM NaCl, 10% glycerol, 1 mM PMSF). Proteins were eluted using amylose elution buffer (50 mM Tris-HCl pH 7.5, 2 mM β-mercaptoethanol, 300 mM NaCl, 10% glycerol, 1 mM PMSF, 10 mM maltose (Sigma), 20 mM imidazole (Sigma)). The solution was immediately loaded onto pre-equilibrated Ni-NTA agarose resin (Qiagen) at 4 °C, in flow. The resin was washed with Ni-NTA buffer 1 (50 mM Tris-HCl pH 7.5, 2 mM β-mercaptoethanol, 10% glycerol, 1 mM PMSF, 20 mM imidazole and 1 M NaCl for BRCA1 or 0.3 M NaCl for BRCA1–BARD1), and subsequently with Ni-NTA buffer 2 (50 mM Tris-HCl pH 7.5, 2 mM β-mercaptoethanol, 150 mM NaCl, 10% glycerol, 1 mM PMSF, 20 mM imidazole). Proteins were eluted with Ni-NTA elution buffer (50 mM Tris-HCl pH 7.5, 2 mM β-mercaptoethanol, 150 mM NaCl, 10% glycerol, 1 mM PMSF, 200 mM imidazole). Fractions containing high protein concentration as estimated by the Bradford assay were pooled, aliquoted, snap-frozen in liquid nitrogen and stored at −80 °C. The BRCA1–BARD1 mutants were purified in the same way. We note that attempts to cleave the MBP tag before Ni-NTA purification resulted in protein precipitation. We could obtain up to roughly 0.6 mg of BRCA1–BARD1 from 1 l of media (approximate stock concentration, 800 nM). For the expression of dephosphorylated BRCA1–BARD1 (λBRCA1–BARD1), the complex was incubated with λ phosphatase at room temperature for 30 min during purification, along with a matched control that was similarly incubated but without λ phosphatase.

Human RPA sequence was cloned from p11d–tRPA construct56 using the primers listed in Supplementary Table 3 provided in the Supplementary Information. Whereas both RPA1 and RPA2 were flanked by the BamHI and NheI restriction sites, RPA3 was flanked by SalI and XbaI. These restriction enzymes were used to generate pFB-RPA1, pFB-RPA2 and pFB-6×His-RPA3 insect expression vectors used for the protein purification. RPA was expressed in Sf9 cells in SFX Insect serum-free medium (Hyclone) using the Bac-to-Bac expression system (Invitrogen), according to the manufacturer’s recommendations. A frozen Sf9 pellet from 2 l of culture was resuspended in lysis buffer (50 mM Tris-HCl pH 7.5, 2 mM β-mercaptoethanol, 1:200 protease inhibitor cocktail, 60 µg ml−1 leupeptin, 1 mM PMSF, 20 mM imidazole, 0.1% NP40) and incubated at 4 °C for 20 min. Glycerol was added to a final concentration of 25%, KCl was added to a final concentration of 325 mM and the cell suspension was incubated at 4 °C for 30 min. The cell suspension was centrifuged at 55,000g at 4 °C for 30 min. The soluble extract was incubated with Ni-NTA affinity resin at 4 °C for 1 h. Ni-NTA resin was washed with wash buffer (50 mM Tris-HCl pH 7.5, 2 mM β-mercaptoethanol, 1 mM PMSF, 10% glycerol, 500 mM KCl, 20 mM imidazole, 0.1% NP40). Protein was eluted using wash buffer containing 300 mM imidazole. The eluate was diluted by adding 2 volumes of buffer A (30 mM HEPES pH 7.5, 1 mM DTT, 1 mM PMSF, 10% glycerol, 500 mM KCl, 0.25 mM EDTA, 0.01% NP40). The diluted fractions were purified on a HiTrap Blue HP column (Cytiva) followed by HiTrap desalting column (Cytiva) as described57. Peak desalted fractions were pooled, diluted with 1 volume of buffer B (30 mM HEPES pH 7.5, 1 mM DTT, 1 mM PMSF, 10% glycerol, 0.25 mM EDTA) and loaded onto two 5 ml HiTrap Heparin columns (Cytiva) connected in tandem. Proteins were eluted using a 30 ml gradient of 50 mM to 1 M KCl in 1 ml fractions. Peak fractions were pooled and diluted to a final concentration of roughly 100 mM KCl with buffer B. The diluted eluate was loaded and further purified on a HiTrap Q column (Cytiva) as previously described57. We could obtain roughly 45 mg of human RPA from 2 l insect cells. The sequences of all primers used for cloning in this study are listed in Supplementary Table 3 provided in the Supplementary Information. Purified recombinant proteins were analysed by using SDS–PAGE denaturing electrophoresis and stained with Coomassie Brilliant Blue (VWR). The final images were acquired with a photo scanner operated with Epson Scan v.3.9.4.0 US software and CanoScan 9000F Mark II scanner operated with ImageCapture v.6.6(525) software.

The sgCtIP (CTCCCGGATCTATACTCCAC) used for depletion of endogenous CtIP in RPE1 EXO1+/+ and RPE1 EXO1−/− cells was cloned into pLentiCRISPR-v2 using BsmBI. The PAM-sequence of this guide RNA (gRNA) was mutated in the full-length pcDNA3.1 CtIP overexpressing constructs (pcDNA3.1_CtIP-WT-2×FLAG and pcDNA3.1_CtIP-S327A-2×FLAG) using site-directed mutagenesis to render the exogenous CtIP expression insensitive to CRISPR-mediated depletion. Subsequently, the coding sequence was cloned into the Gateway entry vector pENTR_1A using KpnI and NotI before transferring it to the destination vector pCW57.1-Zeo using a Gateway LR reaction.

Sequence analysis of BRCA1 and BARD1 proteins

Alignment of the BRCA1 region 931–1171 and of the BARD1 region 123–261 were generated using the MAFFT method58 and represented using Jalview59.

Preparation of DNA substrates

The sequences of all oligonucleotides used for DNA substrate preparation are listed in Supplementary Table 4 provided in the Supplementary Information. The oligonucleotide-based Y-structured DNA substrate was prepared with the oligonucleotides X12-3HJ3 and X12-3TOPLbis35. The oligonucleotide-based 70 bp-long dsDNA substrate was prepared with the oligonucleotides PC210 and PC211. X12-3HJ3 and PC210 oligonucleotides were 32P-labelled at the 3′ terminus with (α-32P)dCTP (Hartmann Analytic) and terminal transferase (New England Biolabs) according to the manufacturer’s instructions. The oligonucleotide-based 70 bp-long dsDNA biotinylated at the 5′ terminus was prepared using the oligonucleotides PC206 and PC217. PC206 oligonucleotide was 32P-labelled at the 5′ terminus with (γ-32P)ATP (Hartmann Analytic) and T4 PNK (New England Biolabs) according to the manufacturer’s instructions. The randomly labelled 2.2 kbp-long substrate was prepared by amplifying the human NBS1 gene by PCR reaction containing 66 nM (α-32P)dCTP (Hartmann Analytic) with the standard dNTPs concentration (200 µM each)27. When randomly labelled ssDNA was required, the 2.2 kbp-long substrate was heated at 95 °C for 5 min before the experiments. The HindIII digest of λ DNA (New England Biolabs) was labelled by fill-in at the 3′ end with (α-32P)dCTP (Hartmann Analytic), dGTP, dATP (0.25 mM each) and 5 U of the Klenow fragment of DNA polymerase I exo- (lacking the 3′–5′ and 5′–3′ exonuclease activities of DNA polymerase I) (New England Biolabs). Unincorporated nucleotides were removed with Micro Bio-Spin P-30 Tris chromatography columns (BioRad). When the heat-denatured substrate was needed, the substrate was incubated at 95 °C for 5 min to obtain ssDNA27. pUC19-based dsDNA substrate was prepared by digesting the pUC19 plasmid with HindIII-HF restriction enzyme (New England Biolabs) according to the manufacturer’s instructions, and purified by phenol-chloroform extraction and ethanol precipitation. The resulting linear dsDNA was labelled by fill-in at the 3′ end with 0.25 mM of (α-32P)dCTP (Hartmann Analytic), dGTP, dATP and 5 U of the Klenow fragment of DNA polymerase I exo- (New England Biolabs). Unincorporated nucleotides were removed using Micro Bio-Spin P-30 Tris chromatography columns (BioRad). For the ATPase assay with wild-type DNA2 and helicase-dead DNA2 D277A, the 10.3 kbp-long pFB-MBP-hMLH3 plasmid60 was linearized with NheI (New England Biolabs) and purified with QIAquick PCR purification kit (Qiagen). The substrate was denatured at 95 °C for 5 min to obtain ssDNA. The overhanging substrate used for single-molecule magnetic tweezer experiments was prepared as previously described61,62. Briefly, the main 6.6 kbp-long fragment was prepared from pNLRep plasmid63 using the restriction enzymes BamHI and BsrGI (New England Biolabs). Furthermore, a 63 nt-long ssDNA gap was introduced using the nicking enzyme Nt.BbvCI (New England Biolabs). The gap was then filled by hybridizing a 25 nt-long DNA oligomer carrying an extra 40 nt-long polythimidine tail at the 5′ end (overhang), followed by 3′ end ligation inside the gap. Subsequently, 600 bp-long DNA handles carrying either several digoxigenin or biotin modifications were attached at either end. The handles were produced by PCR using as a template the plasmids pBlueScript II SK+ (digoxigenin, Dig handle Forward and Dig handle Reverse primers) or pNLRep (biotin, Bio handle Forward and Bio handle Reverse primers), respectively, in the presence of digoxigenin and biotin-modified nucleotides and digested with BamHI or BsrGI (New England Biolabs), respectively. The final construct shows the 5′ overhang at roughly 0.5 kbp distance from the surface attachment handle.

DNA end resection and protection assays

DNA endonuclease assays with the MRN complex and pCtIP were performed in 15 µl volume in nuclease buffer containing 25 mM Tris-acetate pH 7.5, 5 mM magnesium acetate, 1 mM manganese acetate, 1 mM ATP, 1 mM DTT, 0.25 mg ml−1 bovine serum albumin (BSA) (New England Biolabs), 1 mM phosphoenolpyruvate (PEP), 80 U ml−1 pyruvate kinase (Sigma) and 1 nM substrate (in molecules). Biotinylated DNA ends were blocked by adding 15 nM monovalent streptavidin (a kind gift from M. Howarth, University of Oxford)64 and by incubating the samples at room temperature for 5 min. Different from above, DNA exonuclease assays with recombinant MRE11–RAD50 were carried out in nuclease buffer containing 3 mM manganese acetate. Recombinant proteins were added on ice and the reactions were incubated at 37 °C for 2 h. Reactions were stopped by adding 0.5 µl of 0.5 M EDTA and 1 μl Proteinase K (Roche, 18 mg ml−1), and incubated at 50 °C for 30 min. An equal amount of formamide dye (95% [v/v] formamide, 20 mM EDTA, bromophenol blue) was added, samples were heated at 95 °C for 4 min and separated on 15% denaturing polyacrylamide gels (ratio acrylamide:bisacrylamide 19:1, BioRad). After fixing in a solution containing 40% methanol, 10% acetic acid and 5% glycerol for 30 min, the gels were dried on 3MM paper (Whatman), exposed to storage phosphor screens (GE Healthcare) and scanned with Typhoon FLA 9500 Phosphor Imager (GE Healthcare).

DNA end-resection assays with PCR-based or pUC19-based dsDNA substrate were performed in a 15 µl volume in 25 mM Tris-acetate pH 7.5, 2 mM magnesium acetate, 1 mM ATP, 1 mM DTT, 0.1 mg ml−1 BSA, 1 mM PEP, 80 U ml−1 pyruvate kinase and 1 nM substrate (in molecules). NaCl was added to the reaction buffer to a final concentration of 50 mM (unless indicated otherwise) taking into account the salt coming from protein storage or dilution buffers. When randomly labelled ssDNA was used, 2 nM substrate (in molecules) was used. Where indicated, AMP-PNP (Toronto Research Chemicals) or ATP-γ-S (Cayman Chemical) were used instead of ATP. Human RPA was included to saturate all ssDNA, as indicated. Further recombinant proteins were then added on ice and the reactions were incubated at 37 °C for 30 min, unless indicated otherwise. Reactions were stopped by adding 5 µl of 2% stop solution (150 mM EDTA, 2% SDS, 30% glycerol, bromophenol blue) and 1 µl of Proteinase K (Roche, 18 mg ml−1) and incubated at 37 °C for 15 min. Samples were analysed by 1% agarose gel electrophoresis. Gels were dried on DE81 chromatography paper (Whatman) and analysed as described above.

The nuclease assays with λ DNA/HindIII-based substrates were carried out similarly as described above with the following differences. DNA was used at 0.15 nM (in molecules), the reaction buffer contained 3 mM magnesium acetate, 30 mM NaCl and, unless indicated otherwise, reactions were incubated at 37 °C for 1 h. DNA protection assays with PCR-based dsDNA substrate were carried out as indicated above for the respective DNA end resection assays, except RAD51, BRCA1–BARD1 or BRCA1 were pre-incubated at 37 °C for 10 min before the addition of the other recombinant proteins. Protection reactions were stopped by adding 0.5 µl of 0.5 M EDTA and 1 μl of Proteinase K (Roche, 18 mg ml−1), and incubated at 50 °C for 30 min. An equal amount of formamide dye (95% [v/v] formamide, 20 mM EDTA, bromophenol blue) was added, and samples were heated at 95 °C for 4 min and separated on 20% denaturing polyacrylamide gels (ratio acrylamide:bisacrylamide 19:1). After fixing in a solution containing 40% methanol, 10% acetic acid and 5% glycerol for 30 min, the gels were dried on 3MM paper (Whatman) and analysed as described above. Protection assays with pUC19-based dsDNA substrate were carried out as indicated above for the respective DNA end resection assays. Signals were quantified using ImageJ2 (National Institutes of Health, NIH) and plotted with Prism 10 (GraphPad).

Helicase assays

Helicase assays with the oligonucleotide-based Y-structured DNA substrate were performed in 15 µl volume in reaction buffer (25 mM Tris-acetate pH 7.5, 5 mM magnesium acetate, 1 mM ATP, 1 mM DTT, 0.1 mg ml−1 BSA, 1 mM PEP, 80 U ml−1 pyruvate kinase and 50 mM NaCl) with 0.1 nM DNA substrate (in molecules). Recombinant proteins were added as indicated. Reactions were incubated at 37 °C for 30 min and stopped by adding 5 µl of 2% stop solution (150 mM EDTA, 2% SDS, 30% glycerol, bromophenol blue) and 1 µl of Proteinase K (Roche, 18 mg ml−1) and incubated at 37 °C for 10 min. To avoid re-annealing of the substrate, the 2% stop solution was supplemented with a 20-fold excess of the unlabelled oligonucleotide with the same sequence as the 32P-labelled one. The products were separated by 10% polyacrylamide gel electrophoresis, dried on 17 CHR chromatography paper (Whatman) and analysed as described for resection assays. Helicase assays with PCR-based, pUC19-based dsDNA substrate or HindIII digest of λ DNA were performed as described for the respective DNA end resection assays. Signals were quantified using ImageJ2 (NIH) and plotted with Prism 10 (GraphPad).

ATPase assays

ATPase assays with recombinant WRN were performed in 25 mM Tris-acetate pH 7.5, 5 mM magnesium acetate, 1 mM DTT, 0.1 mg ml−1 BSA, 1 mM ATP, 100 mM NaCl, 1 nM of (γ-32P)ATP (Hartmann Analytic) and 0.1 nM (in molecules) of the X12-3HJ3 oligonucleotide used to prepare the Y-structured DNA substrate used in the helicase assays. RPA and BRCA1–BARD1 or BRCA1 were added on ice and samples were pre-incubated at 37 °C for 10 min. WRN was then added and reactions were incubated at 37 °C for 30 min. ATPase assays with recombinant wild-type DNA2 and nuclease-dead DNA2 D277A were performed in 25 mM Tris-acetate pH 7.5, 3 mM magnesium acetate, 1 mM DTT, 0.1 mg ml−1 BSA, 1 mM ATP, 20 mM NaCl, 1 nM of (γ-32P)ATP (Hartmann Analytic) and 0.32 nM (in molecules) of a heat-denatured 10.3 kbp-long dsDNA as a substrate. RPA and indicated proteins were added on ice and samples were incubated at 37 °C for 15 min. Reactions were stopped with 1.1 µl of 0.5 M EDTA, and separated using thin layer chromatography plates (Merck) with 0.3 M LiCl and 0.3 M formic acid as the mobile phase. Dried plates were exposed to storage phosphor screens (GE Healthcare) and scanned with Typhoon FLA 9500 Phosphor Imager (GE Healthcare). Signals were quantified using ImageJ2 (NIH) and plotted with Prism 10 (GraphPad).

Protein-interaction assays

To test the interaction between BRCA1–BARD1 and WRN or EXO1, 1 μg of anti-BRCA1 antibody (Santa Cruz Biotechnology, sc-6954) or anti-WRN antibody (Cell Signaling, 4666S) were captured on 10 μl Protein G magnetic beads (Dynabeads, Invitrogen) by incubating at 4 °C for 1 h with gentle rotation in 50 μl of PBS-T (PBS with 0.1% Tween-20, Sigma). The beads were washed twice on a magnetic rack with 150 μl of PBS-T. The beads were then mixed with 1 μg of the bait in 60 μl of immunoprecipitation buffer (25 mM Tris-HCl pH 7.5, 1 mM DTT, 3 mM EDTA, 0.20 μg μl−1 BSA, 100 mM NaCl) and incubated at 4 °C for 1 h with gentle rotation. Beads were washed three times with 150 μl of wash buffer (25 mM Tris-HCl pH 7.5, 1 mM DTT, 3 mM EDTA, 80 mM NaCl, 0.05% Triton-X, Sigma). Then 1 μg of the prey was added to the beads in 60 μl of immunoprecipitation buffer (25 mM Tris-HCl pH 7.5, 1 mM DTT, 3 mM EDTA, 0.20 μg μl−1 BSA, 100 mM NaCl) and incubated at 4 °C for 1 h with gentle rotation. Beads were again washed three times with 150 μl of wash buffer (25 mM Tris-HCl pH 7.5, 1 mM DTT, 3 mM EDTA, 80 mM NaCl, 0.05% Triton-X) and proteins were eluted by boiling the beads in SDS buffer (50 mM Tris-HCl pH 6.8, 1.6% SDS, 100 mM DTT, 10% glycerol, 0.01% bromophenol blue) at 95 °C for 3 min. Avidin (Sigma) was added to the eluate as a stabilizer. The eluate was separated on a 7.5% SDS–PAGE gel and proteins were detected by western blotting using anti-BRCA1 antibody (Santa Cruz Biotechnology, sc-6954, 1:1,000), anti-His antibody (Invitrogen PA1-983B, 1:1,000) or anti-FLAG antibody (Sigma, F3165, 1:1,000). The final images were acquired with Fusion FX7 capture software (Vilber Imaging).

Mass photometry characterization of protein complexes

Mass photometry measurements were performed on a TwoMP mass photometer (Refeyn Ltd). First, borosilicate microscope glass plate (No. 1.5 H thickness, 24 × 50 mm, VWR) were cleaned by sequential soaking in Milli-Q-water, isopropanol and Milli-Q-water followed by drying under a stream of clean nitrogen. Next, silicone gaskets (CultureWell Reusable Gasket, Grace Bio-Labs) were placed on the clean coverslip to create a defined well for sample delivery. To convert optical reflection-interference contrast into a molecular mass, a known protein size marker (NativeMark Unstained Protein Standard, Invitrogen) was measured on the same day. For mass measurements, gaskets were filled with 18 μl of measurement buffer (25 mM Tris-HCl pH 7.5, 1 mM ATP, 3 mM magnesium acetate) to allow focusing the microscope onto the coverslip surface. Subsequently, 40 nM of either BRCA1 or BRCA1–BARD1 were added into the well (final volume, 20 μl) and sample binding to the coverslip surface was monitored for 1 min using the software AcquireMP (Refeyn Ltd). Data analysis was performed using DiscoverMP software (Refeyn Ltd).

Single-molecule magnetic tweezer experiments

Single-molecule magnetic tweezer experiments were carried out in a custom-built magnetic tweezers setup and operated using a self-developed code in Labview (2016, National Instruments)65. The DNA constructs were linked at their biotinylated ends with streptavidin-coated magnetic beads (Dynabeads M280, Thermo Fisher Scientific) and flushed into the flow cell, where the bottom slide was coated with antidigoxigenin to ensure surface-specific binding. Moving the magnet closer to the flow cell resulted in the stretching of the DNA molecules that were attached to a magnetic bead. Tracking of the magnetic beads for all measurements was conducted at 300 Hz using video microscopy and real-time GPU-accelerated image analysis66. The magnetic forces were calibrated based on fluctuation analysis67. The measurements were performed in a reaction buffer (25 mM Tris-acetate pH 7.5, 2 mM magnesium acetate, 1 mM ATP, 1 mM DTT, 0.1 mg ml−1 BSA), with the indicated protein concentrations at a temperature of 37 °C and forces between 15 and 25 pN. The analysis of the recorded traces was conducted with a custom written MATLAB program68. We considered only traces from measurements in which the magnetic bead position was traceable for at least 300 s. The acquired processivity and velocity for the unwinding events were calculated by fitting linear segments to parts of the recorded traces with roughly constant velocity, which were used to construct the histograms and for statistical analysis. To quantify the ratio of rewinding/unwinding events, the total number of the two events, acquired as described above, was determined for a fixed period of 300 s for each recorded trace. To characterize the different protein combinations (Fig. 3c) and WRN variants (Extended Data Fig. 7e), the difference between the maximum value and the minimum value of DNA extension for a given molecule was calculated during the first 300 s and expressed as ΔDNA-length. Each dot represents one measured molecule.

Cell lines

The RPE1 hTERT were purchased from American Type Culture Collection (ATCC). The RPE1 hTERT PAC−/−TP53−/− cell line (referred to as RPE1 EXO1+/+ in this paper)45 was used to generate RPE1 hTERT PAC−/−TP53−/−EXO1−/− (referred to as RPE1 EXO1−/−) cells by nucleofection of pLentiCRISPR_v2 containing the sgEXO1 (GCGTGGGATTGGATTAGCAA) as described before45. After clonal selection, genotyping was performed to confirm indel formation using target locus PCR amplification and Sanger sequencing, followed by TIDE (tracking of indels by decomposition) analysis. RPE1 EXO1+/+ and EXO1−/− cells inducibly expressing exogenous CtIP-WT or CtIP-S327A were obtained by viral transduction with pCW57.1_Zeo-CtIP-WT-2×FLAG or pCW57.1_Zeo-CtIP-S327A-2×FLAG.

U2OS cells were originally bought from ATCC. U2OS-derived cells, carrying green fluorescent protein (GFP), GFP-CtIP-WT or GFP-CtIP-S327A mutant16, were grown in DMEM medium (Sigma). Media were supplemented with 10% fetal bovine serum (Sigma), 2 mM l-glutamine (Sigma), 100 U ml−1 penicillin and 100 μg ml−1 streptomycin (Sigma). U2OS cells were last authenticated in June 2024 by the GenePrint 10 System (Promega) using short tandem repeat profiling, and data were analysed using genemapper id-x v.1.2 software (Applied Biosystems) at the genomic core facility of the Instituto de Investigaciones Biomedicas Sols-Morreale. All cell lines were routinely tested for mycoplasm contamination. All the experiments performed here used mycoplasm-free cell lines.

Viral transductions and transfections

Third-generation packaging vectors pMDLg/pRRE, pRSV-Rev, pMD2.g and a lentiviral expression vector (pLentiCRISPR-v2 or pCW57.1) were transfected to human embryonic kidney (HEK) 293T using jetPEI (Polyplus Transfection) to produce lentiviral particles. The HEK 293T cell line was originally purchased from ATCC. The medium was refreshed 16 h post-transfection. Viral supernatants were harvested 48 h post-transfection, filtered with a 0.45 mm filter and transduced into cells at a multiplicity of infection of 1 in the presence of 4 μg ml−1 polybrene. Puromycin (2 μg ml−1) and zeocin (400 μg ml−1) were used for the selection of pLentiCRISPR- and pCW57.1- transduced RPE1 cells, respectively.

Clonogenic survival assays

RPE1 EXO1+/+ or EXO1−/− cells transduced with CtIP-WT or CtIP-S327A were induced with doxycycline (2 μg ml−1) to express CtIP protein exogenously. Cells were virally transduced with pLentiCRISPR-sgCtIP or empty vector to deplete endogenous CtIP 24 h post-doxycycline induction. After 48 h of puromycin selection to select for pLentiCRISPR transduced cells, 500 cells were seeded in 10-cm dishes for clonogenic growth. Medium containing doxycycline (2 μg ml−1) was refreshed after 7 days. After 14 days, colonies were stained with crystal violet solution (0.4% [w/v], 20% methanol) and counted manually. Simultaneously with plating cells for clonogenic survival, cells were collected for immunoblotting analysis and lysed in RIPA lysis buffer (1% NP40, 50 mM Tris-HCl pH 7.5, 150 mM NaCl, 0.1% SDS, 3 mM MgCl2, 0.5% sodium deoxycholate) supplemented with Complete Protease Inhibitor Cocktail (Sigma) and 100 U ml−1 Benzonase (Sigma). Western blots were stained with primary antibodies against CtIP (Millipore, MABE1060, 1:2,000), FLAG (Sigma, F1804-200UG, 1:2,000), EXO1 (Abcam, ab95068, 1:1,000) and α-Tubulin (Sigma, T6199, 1:5,000); and with HRP-conjugated secondary antibodies donkey anti-rabbit IgG-HRP (Thermo Scientific, 31458, 1:5,000) or goat anti-mouse IgG-HRP (Thermo Scientific, 31432, 1:5,000).

Immunofluorescence and microscopy

For RPA foci visualization, U2OS-derived cells were seeded on coverslips. For the experiment with DNA2 inhibitor C5 (MedChemExpress, catalogue no. HY128729), 20 μM of the inhibitor or the same amount of vehicle (dimethylsulfoxide, DMSO) were added to the plates 6 h before irradiation. Then 1 h after irradiation (10 Gy), coverslips were washed once with PBS followed by treatment with pre-extraction buffer (25 mM Tris-HCl pH 7.5, 50 mM NaCl, 1 mM EDTA, 3 mM MgCl2, 300 mM sucrose and 0.2% Triton-X-100) for 5 min on ice. Cells were fixed with 4% paraformaldehyde [w/v] in PBS for 20 min. Following two washes with PBS, cells were blocked for 1 h with 5% fetal bovine serum in PBS, costained with the appropriate primary antibodies (RPA2, Abcam, ab2175, 1:500) in blocking solution overnight at 4 °C or for 2 h at room temperature, washed again with PBS and then co-immuno-stained with the appropriate secondary antibodies (Alexa Fluor 594 goat anti-mouse, Invitrogen, A11032, 1:500 and Alexa Fluor 488 goat anti-rabbit, Invitrogen, A11034, 1:500) in blocking buffer. After washing with PBS, coverslips were incubated sequentially in 70% and 100% ethanol to dehydrate them. Finally, they were air dried and mounted into glass slides using Vectashield mounting medium with 4,6-diamidino-2-phenylindole (Vector Laboratories). RPA foci immunofluorescence was analysed using a Leica DM6000B Fluorescence microscope (AF6000).

Cell-cycle analysis

Cells were trypsinized and fixed with cold 70% ethanol overnight, incubated with 250 μg ml−1 RNase A (Sigma) and 10 μg ml−1 propidium iodide (Fluka) at 37 °C for 30 min and analysed with a LSRFortessaTM Cell Analyzer (BD) Flow Cytometer. Cell-cycle distribution data were further analysed using ModFit LT v.5.0 software (Verity Software House Inc.).

Statistics and reproducibility

Sample size or number of technical (for biochemical assays) and biological (for cellular assays) replicates were chosen on the basis of what is common in the field and what was practical to do. A minimum of three independent replicates were performed for each biochemical experiment to add statistical analysis, when required. Where indicated, a representative experiment from independent repeats with similar results was shown. Coomassie-stained protein gels were repeated twice to confirm the quality and the concentration of the indicated recombinant proteins. Protein-interaction assays were performed twice.

Reporting summary

Further information on research design is available in the Nature Portfolio Reporting Summary linked to this article.

RELATED ARTICLES

Most Popular

Recent Comments